Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024819 Citrobacter freundii strain CRCB-101 chromosome, complete genome 1 crisprs DEDDh,WYL,DinG,cas3,csa3 1 0 7 0
NZ_CP024820 Citrobacter freundii strain CRCB-101 plasmid pCRCB-101_1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP024819
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024819_1 2202020-2202114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP024819_1 1.1|2202043|49|NZ_CP024819|CRISPRCasFinder 2202043-2202091 49 NZ_CP024819.1 2202079-2202127 2 0.959

1. spacer 1.1|2202043|49|NZ_CP024819|CRISPRCasFinder matches to position: 2202079-2202127, mismatch: 2, identity: 0.959

atcgaccggtgtgacgtcgctgccgccgtcatcaggatcgaccggtgtg	CRISPR spacer
atcgaccggtgtgacgtcgctgccgccgtcatcagggtcaaccggtgtg	Protospacer
************************************.**.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3093271 : 3161620 81 Klebsiella_phage(27.45%) integrase,portal,tail,holin,protease,capsid,head,terminase attL 3092995:3093011|attR 3131594:3131610
DBSCAN-SWA_2 3232011 : 3237451 7 Escherichia_phage(33.33%) integrase,tRNA attL 3230384:3230396|attR 3235107:3235119
DBSCAN-SWA_3 3664307 : 3674315 10 Tupanvirus(28.57%) tRNA NA
DBSCAN-SWA_4 4022552 : 4063630 43 Escherichia_phage(27.5%) integrase,portal,lysis,tail,tRNA,plate,protease,capsid,head,terminase attL 4027044:4027070|attR 4058315:4058341
DBSCAN-SWA_5 4106326 : 4114751 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_6 4578010 : 4722686 145 Salmonella_phage(53.85%) protease,integrase,portal,lysis,tail,tRNA,holin,plate,transposase,capsid,head,terminase attL 4615217:4615276|attR 4721407:4722721
DBSCAN-SWA_7 5272135 : 5309799 45 Erwinia_phage(34.21%) integrase,portal,lysis,tail,tRNA,plate,capsid,head,terminase attL 5278494:5278541|attR 5309871:5309918
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage