Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024880 Klebsiella aerogenes strain AR_0018 chromosome, complete genome 4 crisprs DEDDh,WYL,DinG,cas3,csa3 2 2 6 0

Results visualization

1. NZ_CP024880
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024880_1 1162601-1162741 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024880_2 1813839-1813911 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024880_3 4425161-4425275 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024880_4 4623731-4623868 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP024880_2 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder 1813863-1813887 25 NZ_CP024880.1 4898045-4898069 1 0.96
NZ_CP024880_1 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder 1162655-1162687 33 NZ_CP024880.1 1953369-1953401 2 0.939
NZ_CP024880_1 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder 1162655-1162687 33 NZ_CP024880.1 3250783-3250815 2 0.939

1. spacer 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder matches to position: 4898045-4898069, mismatch: 1, identity: 0.96

ggctacccgcggtgccgttttttgt	CRISPR spacer
ggctacccgcggtaccgttttttgt	Protospacer
*************.***********

2. spacer 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder matches to position: 1953369-1953401, mismatch: 2, identity: 0.939

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctcttgcttaccggggctacagcgc	Protospacer
**********  *********************

3. spacer 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder matches to position: 3250783-3250815, mismatch: 2, identity: 0.939

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctggcgcttaccggggctacagcgc	Protospacer
**********.*.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024880_2 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder 1813863-1813887 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323589-323613 2 0.92
NZ_CP024880_2 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder 1813863-1813887 25 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 324019-324043 2 0.92
NZ_CP024880_1 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder 1162655-1162687 33 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 99081-99113 3 0.909
NZ_CP024880_2 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder 1813863-1813887 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447689-447713 3 0.88
NZ_CP024880_1 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder 1162655-1162687 33 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 323506-323538 4 0.879
NZ_CP024880_2 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder 1813863-1813887 25 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 447528-447552 4 0.84
NZ_CP024880_1 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder 1162655-1162687 33 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 583050-583082 6 0.818

1. spacer 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggctacccgcggtgccgttttttgt	CRISPR spacer
atctacccgcggtgccgttttttgt	Protospacer
. ***********************

2. spacer 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.92

ggctacccgcggtgccgttttttgt	CRISPR spacer
ggctacccgcggtgccgtttttttg	Protospacer
***********************  

3. spacer 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 3, identity: 0.909

cggtggcgctagtgcttaccggggctacagcgc-	CRISPR spacer
cggtggcgctagcgcttaccggggctac-gcact	Protospacer
************.*************** **.* 

4. spacer 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 3, identity: 0.88

ggctacccgcggtgccgttttttgt	CRISPR spacer
cactactcgcggtgccgttttttgt	Protospacer
 .****.******************

5. spacer 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.879

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctaccgcttaccggggctacaacac	Protospacer
*********** .****************.*.*

6. spacer 2.1|1813863|25|NZ_CP024880|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 4, identity: 0.84

ggctacccgcggtgccgttttttgt	CRISPR spacer
cgctactcgcggtgccgtttttttg	Protospacer
 *****.****************  

7. spacer 1.1|1162655|33|NZ_CP024880|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.818

cggtggcgctagtgcttaccggggctacagcgc	CRISPR spacer
cggtggcgctaacgcttaccggggctaccaacc	Protospacer
***********..*************** .  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 333822 : 426238 98 Escherichia_phage(34.09%) capsid,lysis,holin,head,protease,tRNA,tail,plate,terminase,portal,integrase attL 361829:361871|attR 392876:392918
DBSCAN-SWA_2 1286104 : 1292918 8 Erwinia_phage(42.86%) NA NA
DBSCAN-SWA_3 3047627 : 3052987 6 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_4 3111400 : 3141969 45 Cronobacter_phage(44.12%) terminase,holin,head,tail NA
DBSCAN-SWA_5 3146313 : 3162670 25 Enterobacteria_phage(28.57%) integrase attL 3148840:3148854|attR 3165130:3165144
DBSCAN-SWA_6 3987328 : 4087908 103 Salmonella_phage(25.86%) capsid,transposase,holin,head,tRNA,tail,terminase,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage