Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024974 Streptococcus suis strain CZ130302 chromosome, complete genome 3 crisprs csa3,DinG,cas3,WYL,DEDDh 1 1 13 0

Results visualization

1. NZ_CP024974
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024974_1 756369-756457 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024974_2 872686-872801 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024974_3 1619193-1619271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP024974_1 1.1|756399|29|NZ_CP024974|CRISPRCasFinder 756399-756427 29 NZ_CP024974.1 756067-756095 2 0.931

1. spacer 1.1|756399|29|NZ_CP024974|CRISPRCasFinder matches to position: 756067-756095, mismatch: 2, identity: 0.931

actgtttcgttaaattgaacccgcctaac	CRISPR spacer
actggtccgttaaattgaacccgcctaac	Protospacer
**** *.**********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024974_3 3.1|1619218|29|NZ_CP024974|CRISPRCasFinder 1619218-1619246 29 MN270270 Streptococcus phage phi-SsuJS7_SSU0237, partial genome 5316-5344 5 0.828
NZ_CP024974_3 3.1|1619218|29|NZ_CP024974|CRISPRCasFinder 1619218-1619246 29 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 250725-250753 7 0.759

1. spacer 3.1|1619218|29|NZ_CP024974|CRISPRCasFinder matches to MN270270 (Streptococcus phage phi-SsuJS7_SSU0237, partial genome) position: , mismatch: 5, identity: 0.828

gggaaataaagcgaacgaagttcgctaca	CRISPR spacer
tggaaataaagcgaacaacgttcgcatca	Protospacer
 ***************.* ******  **

2. spacer 3.1|1619218|29|NZ_CP024974|CRISPRCasFinder matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gggaaataaagcgaacgaagttcgctaca	CRISPR spacer
aggaaataaagcgagagaagttcgtatct	Protospacer
.*************. ********.  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34578 : 49563 13 Synechococcus_phage(22.22%) NA NA
DBSCAN-SWA_2 113609 : 162250 40 Streptococcus_phage(20.0%) transposase,holin,tRNA NA
DBSCAN-SWA_3 475249 : 580831 109 Streptococcus_phage(89.04%) terminase,tail,tRNA,integrase,transposase,portal,holin,capsid,head attL 465896:465915|attR 535834:535853
DBSCAN-SWA_4 598795 : 607674 11 Lactococcus_phage(33.33%) transposase NA
DBSCAN-SWA_5 671671 : 739215 57 Streptococcus_phage(77.78%) transposase,holin,protease,tRNA NA
DBSCAN-SWA_6 1103968 : 1146343 35 Lactobacillus_prophage(14.29%) transposase NA
DBSCAN-SWA_7 1308220 : 1316419 12 Streptococcus_phage(71.43%) integrase attL 1300097:1300112|attR 1310499:1310514
DBSCAN-SWA_8 1326144 : 1339147 11 Streptococcus_phage(88.89%) NA NA
DBSCAN-SWA_9 1435791 : 1554729 105 Streptococcus_phage(88.16%) terminase,tail,protease,transposase,portal,holin,capsid,head NA
DBSCAN-SWA_10 1723458 : 1742594 17 Streptococcus_phage(85.71%) transposase NA
DBSCAN-SWA_11 1827253 : 1863493 32 Streptococcus_phage(30.0%) tRNA,protease,transposase NA
DBSCAN-SWA_12 2220676 : 2278711 45 Streptococcus_phage(23.08%) transposase,protease,tRNA NA
DBSCAN-SWA_13 2486257 : 2511278 30 Streptococcus_phage(73.08%) transposase,integrase attL 2495605:2495620|attR 2508007:2508022
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage