Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024964 Entomoplasma melaleucae strain M1 chromosome, complete genome 1 crisprs NA 0 1 0 0

Results visualization

1. NZ_CP024964
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024964_1 367075-367216 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024964_1 1.1|367098|27|NZ_CP024964|CRISPRCasFinder 367098-367124 27 AP022644 Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence 137118-137144 4 0.852
NZ_CP024964_1 1.1|367098|27|NZ_CP024964|CRISPRCasFinder 367098-367124 27 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 72397-72423 5 0.815
NZ_CP024964_1 1.1|367098|27|NZ_CP024964|CRISPRCasFinder 367098-367124 27 MH319748 Marine virus AG-345-E15 Ga0172270_18 genomic sequence 3740-3766 5 0.815
NZ_CP024964_1 1.1|367098|27|NZ_CP024964|CRISPRCasFinder 367098-367124 27 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 62044-62070 6 0.778

1. spacer 1.1|367098|27|NZ_CP024964|CRISPRCasFinder matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 4, identity: 0.852

attaatgatgaaattgaatcgttaaaa	CRISPR spacer
aataatgatgaaattaaattgttaaat	Protospacer
* *************.***.****** 

2. spacer 1.1|367098|27|NZ_CP024964|CRISPRCasFinder matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 5, identity: 0.815

attaatgatgaaattgaatcgttaaaa	CRISPR spacer
attaatgatgaaatggaaacgttcact	Protospacer
************** *** **** *  

3. spacer 1.1|367098|27|NZ_CP024964|CRISPRCasFinder matches to MH319748 (Marine virus AG-345-E15 Ga0172270_18 genomic sequence) position: , mismatch: 5, identity: 0.815

attaatgatgaaattgaatcgttaaaa	CRISPR spacer
tataatgatgaaattgaatatttaata	Protospacer
  *****************  **** *

4. spacer 1.1|367098|27|NZ_CP024964|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 6, identity: 0.778

attaatgatgaaattgaatcgttaaaa	CRISPR spacer
cgtcctgatgaaattgcatcgttaaag	Protospacer
  *  *********** *********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage