1. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
2. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
3. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
4. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
5. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
6. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
7. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
8. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
9. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
10. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
11. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0
agaagattattacgttgagtccaagcctgacgtca CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca Protospacer
***********************************
12. spacer 1.5|513944|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448932 (Streptococcus phage Javan42, complete genome) position: , mismatch: 0, identity: 1.0
aggcaaaagtcaacgagctactcaaacagccaaa CRISPR spacer
aggcaaaagtcaacgagctactcaaacagccaaa Protospacer
**********************************
13. spacer 1.8|514143|35|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0
tagctgatagcctgcaatatacaaccatccgtttt CRISPR spacer
tagctgatagcctgcaatatacaaccatccgtttt Protospacer
***********************************
14. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
15. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
16. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
17. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448952 (Streptococcus phage Javan472, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
18. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
19. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
20. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
21. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
22. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
23. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
24. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
25. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448766 (Streptococcus phage Javan465, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
26. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
27. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
28. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
29. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
30. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
31. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
32. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
33. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
34. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
35. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
36. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
37. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccactagcatcacctaccaatct Protospacer
******************************
38. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
39. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448959 (Streptococcus phage Javan488, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
40. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
41. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
42. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
43. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
44. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca Protospacer
******************************
45. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
46. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
47. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448952 (Streptococcus phage Javan472, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
48. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
49. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
50. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
51. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
52. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
53. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
54. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
55. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448766 (Streptococcus phage Javan465, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
56. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
57. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
58. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
59. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
60. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
61. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
62. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
63. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
64. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
65. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
66. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcgcttctgagtgttgattcatactcttta Protospacer
******************************
67. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0
aaattctttgcttgattaattaattcgtct CRISPR spacer
aaattctttgcttgattaattaattcgtct Protospacer
******************************
68. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0
aaattctttgcttgattaattaattcgtct CRISPR spacer
aaattctttgcttgattaattaattcgtct Protospacer
******************************
69. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0
aaattctttgcttgattaattaattcgtct CRISPR spacer
aaattctttgcttgattaattaattcgtct Protospacer
******************************
70. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0
aaattctttgcttgattaattaattcgtct CRISPR spacer
aaattctttgcttgattaattaattcgtct Protospacer
******************************
71. spacer 2.10|916489|30|NZ_CP025028|CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0
tcctctttctatgtttcaattgccaatttt CRISPR spacer
tcctctttctatgtttcaattgccaatttt Protospacer
******************************
72. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0
attctttgcttgattaattaattcg CRISPR spacer
attctttgcttgattaattaattcg Protospacer
*************************
73. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0
attctttgcttgattaattaattcg CRISPR spacer
attctttgcttgattaattaattcg Protospacer
*************************
74. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0
attctttgcttgattaattaattcg CRISPR spacer
attctttgcttgattaattaattcg Protospacer
*************************
75. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0
attctttgcttgattaattaattcg CRISPR spacer
attctttgcttgattaattaattcg Protospacer
*************************
76. spacer 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.971
gtcgtaaagacgtagcatatcactaattagatca CRISPR spacer
gtcgtaaagacgtagcatatcactaattaaatca Protospacer
*****************************.****
77. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 1, identity: 0.967
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcacttctgagtgttgattcatactcttta Protospacer
**.***************************
78. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 1, identity: 0.967
gcgcttctgagtgttgattcatactcttta CRISPR spacer
gcacttctgagtgttgattcatactcttta Protospacer
**.***************************
79. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
80. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
81. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
82. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
83. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
84. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
85. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
86. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
87. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
88. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
89. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
90. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
91. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
92. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
93. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
94. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
95. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 1, identity: 0.967
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat Protospacer
.*****************************
96. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
tcaatcacgttcgattcgtgatgggtctat Protospacer
..****************************
97. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat Protospacer
.*****.***********************
98. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat Protospacer
.*****.***********************
99. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat Protospacer
.*****.***********************
100. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat Protospacer
.*****.***********************
101. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat Protospacer
.*****.***********************
102. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 2, identity: 0.933
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat Protospacer
.*****.***********************
103. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 2, identity: 0.933
aatattacattgataatgtagtagaattct CRISPR spacer
aatattatattgataatgtagtagagttct Protospacer
*******.*****************.****
104. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 2, identity: 0.933
aatattacattgataatgtagtagaattct CRISPR spacer
aatattatattgataatgtagtagagttct Protospacer
*******.*****************.****
105. spacer 2.10|916489|30|NZ_CP025028|CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.933
tcctctttctatgtttcaattgccaatttt CRISPR spacer
tcctctttctgtgtttcagttgccaatttt Protospacer
**********.*******.***********
106. spacer 2.10|916489|30|NZ_CP025028|CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 2, identity: 0.933
tcctctttctatgtttcaattgccaatttt CRISPR spacer
tcctctttctgtgtttcagttgccaatttt Protospacer
**********.*******.***********
107. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 2, identity: 0.92
tattacattgataatgtagtagaat CRISPR spacer
tattatattgataatgtagtagagt Protospacer
*****.*****************.*
108. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 2, identity: 0.92
tattacattgataatgtagtagaat CRISPR spacer
tattatattgataatgtagtagagt Protospacer
*****.*****************.*
109. spacer 1.5|513944|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 3, identity: 0.912
aggcaaaagtcaacgagctactcaaacagccaaa CRISPR spacer
aagcaaaagtcaacgagctactcaaacaaccaca Protospacer
*.**************************.*** *
110. spacer 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 3, identity: 0.912
gtcgtaaagacgtagcatatcactaattagatca CRISPR spacer
atcgtaaagacgtagcatatcactaattaagtca Protospacer
.****************************..***
111. spacer 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 3, identity: 0.912
gtcgtaaagacgtagcatatcactaattagatca CRISPR spacer
gtcgtaaagacgtagcatatcactaattaagtcg Protospacer
*****************************..**.
112. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
113. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
114. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
115. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
116. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019920 (Borreliella burgdorferi strain PAbe plasmid p_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
117. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
118. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
119. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
120. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP018755 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid cp32, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
121. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
122. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
123. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
124. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
125. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
126. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019004 (Borrelia burgdorferi 297 plasmid 297_cp32-11, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
127. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
128. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
129. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
130. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
131. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017424 (Borreliella burgdorferi N40 plasmid N40_cp32-10, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
132. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
133. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017423 (Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
134. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017400 (Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
135. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017393 (Borreliella burgdorferi JD1 plasmid JD1 cp32-11, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
136. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
137. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
138. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
139. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017397 (Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
140. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
141. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
142. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
143. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
144. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
145. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
146. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028864 (Borreliella garinii strain 20047 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
147. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028868 (Borreliella garinii strain 20047 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
148. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
149. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028880 (Borreliella bavariensis PBi plasmid cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
150. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
151. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
152. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000949 (Borreliella burgdorferi B31 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
153. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
154. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
155. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
156. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
157. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015800 (Borrelia mayonii strain MN14-1539 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
158. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
159. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
160. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
161. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019847 (Borreliella burgdorferi plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
162. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019848 (Borreliella burgdorferi plasmid cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
163. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
164. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
165. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
166. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
167. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
168. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019758 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
169. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019759 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
170. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
171. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
172. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
173. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
174. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
175. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
176. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017204 (Borreliella burgdorferi strain B331 plasmid B331_cp32_10, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
177. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
178. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
179. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017207 (Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
180. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
181. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
182. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015784 (Borrelia mayonii strain MN14-1420 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84
tattacattgataatgtagtagaat CRISPR spacer
aattacattgaaaatgtagcagaag Protospacer
********** *******.****
183. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MH616653 (Microviridae sp. isolate ctbj22, complete genome) position: , mismatch: 4, identity: 0.84
attctttgcttgattaattaattcg CRISPR spacer
attctttgcttgattaatttctttt Protospacer
******************* **.
184. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MN693930 (Marine virus AFVG_250M489, complete genome) position: , mismatch: 4, identity: 0.84
attctttgcttgattaattaattcg CRISPR spacer
attatctgcttgattaattaatttt Protospacer
*** *.*****************.
185. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 5, identity: 0.844
taataatg-attatttttttattaattcattat CRISPR spacer
-aaaactgtattatttttatataaattcattat Protospacer
** * ** ********* *** **********
186. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 5, identity: 0.833
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgtccattagcatcacctacatttct Protospacer
****** ***.************* ***
187. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 5, identity: 0.833
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgtccattagcatcacctacatttct Protospacer
****** ***.************* ***
188. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 5, identity: 0.833
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgtccattagcatcacctacatttct Protospacer
****** ***.************* ***
189. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 5, identity: 0.833
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgtccattagcatcacctacatttct Protospacer
****** ***.************* ***
190. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448927 (Streptococcus phage Javan394, complete genome) position: , mismatch: 5, identity: 0.833
ttcttgaccactagcatcacct-accaatct CRISPR spacer
ttcatgaccactagcatcatctaaataatc- Protospacer
*** ***************.** * .****
191. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 5, identity: 0.833
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatatctgcgcactgca Protospacer
****************.****.** * .**
192. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448702 (Streptococcus phage Javan199, complete genome) position: , mismatch: 5, identity: 0.833
cttaatagtagatgatgtctgtgctcaaca CRISPR spacer
cttaatagtagatgatatctgcgcactgca Protospacer
****************.****.** * .**
193. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to NZ_AP019552 (Athalassotoga saccharophila strain NAS-01 plasmid pATS1, complete sequence) position: , mismatch: 5, identity: 0.8
attctttgcttgattaattaattcg CRISPR spacer
tctctttgcttgattaattcattta Protospacer
.***************** ***..
194. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 5, identity: 0.8
attctttgcttgattaattaattcg CRISPR spacer
gttttttgcttgattaattaatgtt Protospacer
.**.****************** .
195. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 5, identity: 0.8
attctttgcttgattaattaattcg CRISPR spacer
gttttttgcttgattaattaatgtt Protospacer
.**.****************** .
196. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824
tattttatattaaaaataagactaccataattat- CRISPR spacer
tattttatattgaaaataagaata-aataagaatg Protospacer
***********.********* ** **** **
197. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.812
taataatgattatttttttattaattcattat CRISPR spacer
tattaatgattatttttttattagcaaatttt Protospacer
** ********************.. *** *
198. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP038623 (Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence) position: , mismatch: 6, identity: 0.812
taataatgattatttttttattaattcattat CRISPR spacer
taataatgattatttagttattaacatataat Protospacer
*************** *******. .** **
199. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_017421 (Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence) position: , mismatch: 6, identity: 0.812
taata-atgattatttttttattaattcattat CRISPR spacer
-aatacctccttatttttttagttattcattat Protospacer
**** * *********** * *********
200. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_001856 (Borreliella burgdorferi B31 plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812
taata-atgattatttttttattaattcattat CRISPR spacer
-aatacctccttatttttttagttattcattat Protospacer
**** * *********** * *********
201. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP019853 (Borreliella burgdorferi plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812
taata-atgattatttttttattaattcattat CRISPR spacer
-aatacctccttatttttttagttattcattat Protospacer
**** * *********** * *********
202. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP019764 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence) position: , mismatch: 6, identity: 0.812
taata-atgattatttttttattaattcattat CRISPR spacer
-aatacctccttatttttttagttattcattat Protospacer
**** * *********** * *********
203. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to CP002962 (Emticicia oligotrophica DSM 17448 plasmid pEMTOL01, complete sequence) position: , mismatch: 6, identity: 0.8
caattataacaacaataaagtatgtaattc CRISPR spacer
caaaagaatcaacaaaaaagtatgtaattc Protospacer
*** . * ****** **************
204. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 6, identity: 0.8
caattataacaacaataaagtatgtaattc CRISPR spacer
cccttttaacaacaatgaagtatgtactgc Protospacer
* ** **********.********* * *
205. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 6, identity: 0.8
caattataacaacaataaagtatgtaattc CRISPR spacer
cccttttaacaacaatgaagtatgtactgc Protospacer
* ** **********.********* * *
206. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 6, identity: 0.8
caattataacaacaataaagtatgtaattc CRISPR spacer
cccttttaacaacaatgaagtatgtactgc Protospacer
* ** **********.********* * *
207. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 6, identity: 0.8
caattataacaacaataaagtatgtaattc CRISPR spacer
cccttttaacaacaatgaagtatgtactgc Protospacer
* ** **********.********* * *
208. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 6, identity: 0.8
caattataacaacaataaagtatgtaattc CRISPR spacer
cccttttaacaacaatgaagtatgtactgc Protospacer
* ** **********.********* * *
209. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP018755 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid cp32, complete sequence) position: , mismatch: 6, identity: 0.8
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagact Protospacer
.* ********** *******.**** **
210. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028864 (Borreliella garinii strain 20047 plasmid cp32-3, complete sequence) position: , mismatch: 6, identity: 0.8
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagact Protospacer
.* ********** *******.**** **
211. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028868 (Borreliella garinii strain 20047 plasmid cp32-6, complete sequence) position: , mismatch: 6, identity: 0.8
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagact Protospacer
.* ********** *******.**** **
212. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 6, identity: 0.8
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagact Protospacer
.* ********** *******.**** **
213. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028880 (Borreliella bavariensis PBi plasmid cp32-5, complete sequence) position: , mismatch: 6, identity: 0.8
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagact Protospacer
.* ********** *******.**** **
214. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR214985 (Mycoplasma cynos strain NCTC10142 plasmid 12) position: , mismatch: 6, identity: 0.8
aaattctttgcttgattaattaattcgtct CRISPR spacer
aattcaattgcttgattaattaatttttct Protospacer
** *. ******************. ***
215. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR214985 (Mycoplasma cynos strain NCTC10142 plasmid 12) position: , mismatch: 6, identity: 0.8
aaattctttgcttgattaattaattcgtct CRISPR spacer
aattcaattgcttgattaattaatttttct Protospacer
** *. ******************. ***
216. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
aaattctttgcttgattaattaattcgtct CRISPR spacer
aattcaattgcttgattaattaatttttct Protospacer
** *. ******************. ***
217. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN693696 (Marine virus AFVG_250M1082, complete genome) position: , mismatch: 6, identity: 0.8
aaattct----ttgcttgattaattaattcgtct CRISPR spacer
----tctacgattgcttgattaataaattcgttt Protospacer
*** ************* *******.*
218. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN694110 (Marine virus AFVG_250M1083, complete genome) position: , mismatch: 6, identity: 0.8
aaattct----ttgcttgattaattaattcgtct CRISPR spacer
----tctacgattgcttgattaataaattcgttt Protospacer
*** ************* *******.*
219. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN694066 (Marine virus AFVG_250M1081, complete genome) position: , mismatch: 6, identity: 0.8
aaattct----ttgcttgattaattaattcgtct CRISPR spacer
----tctacgattgcttgattaataaattcgttt Protospacer
*** ************* *******.*
220. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN693930 (Marine virus AFVG_250M489, complete genome) position: , mismatch: 6, identity: 0.8
aaattctttgcttgattaattaattcgtct CRISPR spacer
atattatctgcttgattaattaatttttgt Protospacer
* *** *.*****************. * *
221. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP048628 (Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence) position: , mismatch: 6, identity: 0.8
tcctctttctatgtttcaattgccaatttt CRISPR spacer
gcctttttctatgtttaaattgcctaatct Protospacer
***.*********** ******* * *.*
222. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.781
taataatgattatttttttattaattcattat- CRISPR spacer
agataatgatttgttttttattaatat-ttata Protospacer
.********* ************ . ****
223. spacer 1.10|514276|32|NZ_CP025028|CRT matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781
taataatgattatttttttattaattcattat CRISPR spacer
ttctaataattttttttttattaattctggat Protospacer
* ****.*** *************** **
224. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaattccttttttattaattcattag Protospacer
*.** * .*** .******************
225. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaattccttttttattaattcattag Protospacer
*.** * .*** .******************
226. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaatttcttttttattaattcattag Protospacer
*.** * .*** .******************
227. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaattccttttttattaattcattag Protospacer
*.** * .*** .******************
228. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaattccttttttattaattcattag Protospacer
*.** * .*** .******************
229. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaattccttttttattaattcattag Protospacer
*.** * .*** .******************
230. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaatttcttttttattaattcattag Protospacer
*.** * .*** .******************
231. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.781
taata-atgattatttttttattaattcattat CRISPR spacer
-agtataaaattccttttttattaattcattag Protospacer
*.** * .*** .******************
232. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_020380 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence) position: , mismatch: 7, identity: 0.781
--taataatgattatttttttattaattcattat CRISPR spacer
cgtagtgtt--ttatttttttattaattatttat Protospacer
**.*. * ***************** ****
233. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MH517022 (Acinetobacter phage SH-Ab 15599, complete genome) position: , mismatch: 7, identity: 0.781
taataatgattatttttttat--taattcattat CRISPR spacer
taatagtgattatttttctattataatacgtc-- Protospacer
*****.***********.*** **** *.*.
234. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MK496784 (Capybara microvirus Cap3_SP_414, complete genome) position: , mismatch: 7, identity: 0.781
taataatgattatttttttattaattcattat- CRISPR spacer
tcgtaataatgatttttttattaatt-acgata Protospacer
* .****.** *************** *. **
235. spacer 1.10|514276|32|NZ_CP025028|CRT matches to U72945 (Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region) position: , mismatch: 7, identity: 0.781
-taataatgattatttttttattaattcattat CRISPR spacer
tccataa-aattatttttttattaattgtttaa Protospacer
. **** .****************** ***
236. spacer 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 7, identity: 0.767
gtcaaaagaaaaagattagtcatcacactg CRISPR spacer
attggaggaagaagattagtcatcacattg Protospacer
.*...*.***.****************.**
237. spacer 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 7, identity: 0.767
gtcaaaagaaaaagattagtcatcacactg CRISPR spacer
attggaggaagaagattagtcatcacattg Protospacer
.*...*.***.****************.**
238. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
239. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
240. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
241. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
242. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019920 (Borreliella burgdorferi strain PAbe plasmid p_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
243. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
244. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
245. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
246. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
247. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
248. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
249. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
250. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
251. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019004 (Borrelia burgdorferi 297 plasmid 297_cp32-11, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
252. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
253. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
254. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
255. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
256. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017424 (Borreliella burgdorferi N40 plasmid N40_cp32-10, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
257. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
258. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017423 (Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
259. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017400 (Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
260. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017393 (Borreliella burgdorferi JD1 plasmid JD1 cp32-11, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
261. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
262. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
263. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
264. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017397 (Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
265. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
266. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
267. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
268. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
269. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
270. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
271. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
272. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
273. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000949 (Borreliella burgdorferi B31 plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
274. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
275. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
276. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
277. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
278. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015800 (Borrelia mayonii strain MN14-1539 plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
279. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
280. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
281. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
282. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019847 (Borreliella burgdorferi plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
283. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019848 (Borreliella burgdorferi plasmid cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
284. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
285. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
286. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
287. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
288. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
289. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019758 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
290. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019759 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
291. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
292. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
293. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
294. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
295. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
296. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
297. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017204 (Borreliella burgdorferi strain B331 plasmid B331_cp32_10, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
298. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
299. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
300. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017207 (Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
301. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
302. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
303. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015784 (Borrelia mayonii strain MN14-1420 plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gaaattacattgaaaatgtagcagaagatt Protospacer
.* ********** *******.**** .*
304. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN034827 (Leviviridae sp. isolate H4_Bulk_46_scaffold_544 RNA-dependent RNA polymerase (H4Bulk46544_000001), hypothetical protein (H4Bulk46544_000002), hypothetical protein (H4Bulk46544_000003), and hypothetical protein (H4Bulk46544_000004) genes, complete cds) position: , mismatch: 7, identity: 0.767
aatattacattgataatgtagtagaattct CRISPR spacer
gatattacatttataatgtaatagcggcct Protospacer
.********** ********.*** . .**
305. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaattctttgcttgattaattaattcgtct CRISPR spacer
aaattttttgcttgataaattaatattttc Protospacer
*****.********** ******* . *..
306. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 7, identity: 0.767
aaattctttgcttgattaattaattcgtct CRISPR spacer
ttgttttttgcttgattaattaatgtttct Protospacer
.**.****************** . ***
307. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 7, identity: 0.767
aaattctttgcttgattaattaattcgtct CRISPR spacer
ttgttttttgcttgattaattaatgtttct Protospacer
.**.****************** . ***
308. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
309. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
310. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
311. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
312. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
313. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
314. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
315. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
316. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
317. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
318. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
319. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
320. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
321. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
322. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
323. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaatata Protospacer
. .************* * ******** *
324. spacer 3.5|1955110|42|NZ_CP025028|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 7, identity: 0.833
taacgtctggtttaacttctggcttagcctctggtttggctt CRISPR spacer
tagcaaccggtttaacttctggcttagcctctgccttggctg Protospacer
**.*. *.************************* .******
325. spacer 3.5|1955110|42|NZ_CP025028|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 7, identity: 0.833
taacgtctggtttaacttctggcttagcctctggtttggctt CRISPR spacer
tagcaaccggtttaacttctggcttagcctctgccttggctg Protospacer
**.*. *.************************* .******
326. spacer 3.7|1955206|30|NZ_CP025028|CRT matches to NC_048797 (Bacillus phage vB_BmeM-Goe8, complete genome) position: , mismatch: 7, identity: 0.767
tagcttctggcttaacgtctggcttaacat CRISPR spacer
ctgcttctggcttaacctctggctctgctt Protospacer
. ************** *******. .* *
327. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.765
tattttatattaaaaataagactaccataattat CRISPR spacer
gtgtttatattaaacataagactaacatttttgt Protospacer
*********** ********* *** **.*
328. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.765
tattttat-attaaaaataagactaccataattat CRISPR spacer
-gtaaaatgattaaaaataagactactttaatttt Protospacer
.* ** *****************. ***** *
329. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_015901 (Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence) position: , mismatch: 8, identity: 0.765
tattttatattaaaaataagactaccataattat CRISPR spacer
tattttatattaaaaattagaataatagaaatta Protospacer
***************** *** ** .* ** *
330. spacer 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 8, identity: 0.765
atcat-atctctataatttcctttcatatcaacgc CRISPR spacer
-ttatgagtgctataatttccttttagatcaacga Protospacer
*.** * . **************.* *******
331. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP029456 (Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence) position: , mismatch: 8, identity: 0.75
taataat-gattatttttttattaattcattat CRISPR spacer
-agcattggattatttttctattaattaatttc Protospacer
*..* * **********.******** *** .
332. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaattcattat CRISPR spacer
ttgttaatattattttttcattaatttattaa Protospacer
* .* * **********.*******.****
333. spacer 1.10|514276|32|NZ_CP025028|CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaattcattat CRISPR spacer
tatattttattatttttttattagtttattaa Protospacer
** * ***************.**.****
334. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaattcattat CRISPR spacer
ttgttaatattattttttcattaatttattaa Protospacer
* .* * **********.*******.****
335. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaattcattat CRISPR spacer
ttgttaatattattttttcattaatttattaa Protospacer
* .* * **********.*******.****
336. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaattcattat CRISPR spacer
ttgttaatattattttttcattaatttattaa Protospacer
* .* * **********.*******.****
337. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaat-----tcattat CRISPR spacer
ttattatgattatttatttattaataatgctc----- Protospacer
* ** ********** ********* **
338. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaat-----tcattat CRISPR spacer
ttattatgattatttatttattaataatgctc----- Protospacer
* ** ********** ********* **
339. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 8, identity: 0.75
taataatgattatttttttattaat-----tcattat CRISPR spacer
ttattatgattatttatttattaataatgctc----- Protospacer
* ** ********** ********* **
340. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045128 (Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence) position: , mismatch: 8, identity: 0.733
ttcttgaccactagcatcacctaccaatct CRISPR spacer
ttcttgaccattagcatcatctacagtcgc Protospacer
**********.********.**** . . .
341. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MT774391 (CrAssphage cr126_1, complete genome) position: , mismatch: 8, identity: 0.733
gcgcttctgagtgttgattcatactcttta CRISPR spacer
aagcttctaagtgatgattcatactatact Protospacer
. ******.**** *********** * .
342. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 8, identity: 0.733
ctaatcacgttcgattcgtgatgggtctat CRISPR spacer
--------gttcgattcgtgatgggtctat Protospacer
**********************
343. spacer 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.733
gtcaaaagaaaaagattagtcatcacactg CRISPR spacer
ataaaaagaaaaagattagtcttcgaccaa Protospacer
.* ****************** **. * .
344. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 8, identity: 0.733
aaattctttgcttgattaattaattcgtct CRISPR spacer
gtaacttttccttgattaattaattcttca Protospacer
. * ..*** **************** **
345. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_048803 (Proteus phage Myduc, complete genome) position: , mismatch: 8, identity: 0.733
aaattctttgcttgattaattaattcgtct CRISPR spacer
aaattctttgcttgcttcattaagcggaaa Protospacer
************** ** ***** . *
346. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 8, identity: 0.733
tcctctttctatgtttcaattgccaatttt CRISPR spacer
cattctttctatgtttaatttgccaataac Protospacer
. .************* * ******** .
347. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.735
tattttata------ttaaaaataagactaccataattat CRISPR spacer
------ataaacactttaaaaataatactacaataattaa Protospacer
*** ********** ***** *******
348. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
ctcctaaatttatttttttataaattcattat Protospacer
. . * . ************ **********
349. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
ctcctaaatttatttttttataaattcattat Protospacer
. . * . ************ **********
350. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
agataatgattacttttatattaatagttttg Protospacer
.**********.**** ******* **
351. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_AP017932 (Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
352. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
353. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP021933 (Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
354. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP017376 (Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
355. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP021472 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
356. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
357. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP031209 (Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
358. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP035015 (Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
359. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttatta-attcattat CRISPR spacer
taataatgataatttttttgttacacctgcca- Protospacer
********** ********.*** *......*
360. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
361. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP046038 (Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
362. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP017410 (Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
363. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_016608 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
364. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP029967 (Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
365. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP028336 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
366. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
367. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP018183 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
caataatcattgtttttttattaaattgggtt Protospacer
.****** ***.************ *.. *
368. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
tttacttacttacttttttattaattcaatat Protospacer
* *. ***.*************** ***
369. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_010353 (Streptococcus phage 858, complete genome) position: , mismatch: 9, identity: 0.719
taataatgattatttttttattaattcattat CRISPR spacer
tttacttacttacttttttattaattcaatat Protospacer
* *. ***.*************** ***
370. spacer 3.7|1955206|30|NZ_CP025028|CRT matches to NC_011759 (Yersinia pseudotuberculosis pGDT4 plasmid) position: , mismatch: 9, identity: 0.7
tagcttctggcttaacgtctggcttaacat CRISPR spacer
ggccggactgcttagcgtctggcttaacat Protospacer
. * . *****.***************
371. spacer 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706
atcatatctctataatttcctttcatatcaacgc CRISPR spacer
cttatatctttataattttctttcatatagtttg Protospacer
*.******.********.********* . .
372. spacer 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706
atcatatctctataatttcctttcatatcaacgc CRISPR spacer
cttatatctttataattttctttcatatagtttg Protospacer
*.******.********.********* . .
373. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.688
taataatgattatttttttattaattcattat CRISPR spacer
aagggtagattattttttcatttattcatttc Protospacer
*. . ***********.*** ******* .
374. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 11, identity: 0.676
tattttatattaaaaataagactaccataattat CRISPR spacer
tattttatattaaaaataaaattagtggtgaaaa Protospacer
*******************.*.** .. . *
375. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 11, identity: 0.656
taataatgattatttttttattaattcattat CRISPR spacer
cccatttgaatatttatttattaattcatcta Protospacer
. *** ***** *************.