Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025028 Streptococcus agalactiae strain SGEHI2015-95 chromosome, complete genome 4 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2,DinG,cas9,csn2,csm6,DEDDh,WYL,csa3 1 20 7 2

Results visualization

1. NZ_CP025028
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025028_1 513647-514339 TypeI I-C
10 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025028_2 915859-916554 TypeII II-A
10 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025028_3 1954792-1955289 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025028_4 2004839-2004925 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP025028_3 3.8|1955254|18|NZ_CP025028|CRT 1955254-1955271 18 NZ_CP025028.1 2054633-2054650 2 0.889

1. spacer 3.8|1955254|18|NZ_CP025028|CRT matches to position: 2054633-2054650, mismatch: 2, identity: 0.889

taacttctggcttagctt	CRISPR spacer
tagcttcttgcttagctt	Protospacer
**.***** *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448736 Streptococcus phage Javan35, complete genome 35771-35805 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448781 Streptococcus phage Javan5, complete genome 37793-37827 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448938 Streptococcus phage Javan44, complete genome 35772-35806 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448729 Streptococcus phage Javan31, complete genome 36244-36278 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448911 Streptococcus phage Javan34, complete genome 35771-35805 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448742 Streptococcus phage Javan37, complete genome 35302-35336 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448691 Streptococcus phage Javan17, complete genome 36244-36278 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448916 Streptococcus phage Javan36, complete genome 35771-35805 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448708 Streptococcus phage Javan23, complete genome 37790-37824 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448897 Streptococcus phage Javan28, complete genome 37791-37825 0 1.0
NZ_CP025028_1 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513679-513713 35 MK448948 Streptococcus phage Javan46, complete genome 36187-36221 0 1.0
NZ_CP025028_1 1.5|513944|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513944-513977 34 MK448932 Streptococcus phage Javan42, complete genome 35042-35075 0 1.0
NZ_CP025028_1 1.8|514143|35|NZ_CP025028|CRISPRCasFinder,CRT 514143-514177 35 MK448768 Streptococcus phage Javan47, complete genome 34297-34331 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448852 Streptococcus phage Javan140, complete genome 18039-18068 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448871 Streptococcus phage Javan196, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448784 Streptococcus phage Javan505, complete genome 19112-19141 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448952 Streptococcus phage Javan472, complete genome 18609-18638 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448779 Streptococcus phage Javan497, complete genome 17852-17881 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448947 Streptococcus phage Javan458, complete genome 19112-19141 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448976 Streptococcus phage Javan528, complete genome 18036-18065 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448961 Streptococcus phage Javan494, complete genome 18036-18065 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448697 Streptococcus phage Javan185, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448968 Streptococcus phage Javan512, complete genome 17852-17881 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448693 Streptococcus phage Javan177, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448766 Streptococcus phage Javan465, complete genome 19003-19032 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448696 Streptococcus phage Javan183, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 NC_009819 Streptococcus phage P9, complete genome 18260-18289 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448797 Streptococcus phage Javan531, complete genome 17852-17881 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448689 Streptococcus phage Javan163, complete genome 19112-19141 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448868 Streptococcus phage Javan188, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448866 Streptococcus phage Javan184, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448974 Streptococcus phage Javan524, complete genome 19112-19141 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448699 Streptococcus phage Javan189, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448789 Streptococcus phage Javan513, complete genome 19111-19140 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448678 Streptococcus phage Javan135, complete genome 18027-18056 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 NC_004589 Streptococcus prophage 315.6, complete genome 17949-17978 0 1.0
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448867 Streptococcus phage Javan186, complete genome 19075-19104 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448965 Streptococcus phage Javan506, complete genome 5255-5284 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448959 Streptococcus phage Javan488, complete genome 5255-5284 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448729 Streptococcus phage Javan31, complete genome 6653-6682 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448949 Streptococcus phage Javan460, complete genome 5255-5284 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448691 Streptococcus phage Javan17, complete genome 6653-6682 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448948 Streptococcus phage Javan46, complete genome 6653-6682 0 1.0
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448768 Streptococcus phage Javan47, complete genome 6654-6683 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448871 Streptococcus phage Javan196, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448784 Streptococcus phage Javan505, complete genome 22973-23002 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448952 Streptococcus phage Javan472, complete genome 22478-22507 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448779 Streptococcus phage Javan497, complete genome 21727-21756 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448947 Streptococcus phage Javan458, complete genome 22973-23002 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448976 Streptococcus phage Javan528, complete genome 21912-21941 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448961 Streptococcus phage Javan494, complete genome 21905-21934 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448697 Streptococcus phage Javan185, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448968 Streptococcus phage Javan512, complete genome 21727-21756 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448693 Streptococcus phage Javan177, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448766 Streptococcus phage Javan465, complete genome 22872-22901 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448696 Streptococcus phage Javan183, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 NC_009819 Streptococcus phage P9, complete genome 22135-22164 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448797 Streptococcus phage Javan531, complete genome 21727-21756 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448689 Streptococcus phage Javan163, complete genome 22973-23002 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448868 Streptococcus phage Javan188, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448866 Streptococcus phage Javan184, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448974 Streptococcus phage Javan524, complete genome 22973-23002 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448699 Streptococcus phage Javan189, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448789 Streptococcus phage Javan513, complete genome 22972-23001 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 NC_004589 Streptococcus prophage 315.6, complete genome 21824-21853 0 1.0
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448867 Streptococcus phage Javan186, complete genome 22950-22979 0 1.0
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MK448729 Streptococcus phage Javan31, complete genome 31758-31787 0 1.0
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MK448691 Streptococcus phage Javan17, complete genome 31758-31787 0 1.0
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MK448948 Streptococcus phage Javan46, complete genome 31702-31731 0 1.0
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MK448768 Streptococcus phage Javan47, complete genome 33410-33439 0 1.0
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 MK448837 Streptococcus phage Javan10, complete genome 6972-7001 0 1.0
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 MK448729 Streptococcus phage Javan31, complete genome 31761-31785 0 1.0
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 MK448691 Streptococcus phage Javan17, complete genome 31761-31785 0 1.0
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 MK448948 Streptococcus phage Javan46, complete genome 31705-31729 0 1.0
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 MK448768 Streptococcus phage Javan47, complete genome 33413-33437 0 1.0
NZ_CP025028_1 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 514077-514110 34 MK448851 Streptococcus phage Javan14, complete genome 34030-34063 1 0.971
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448852 Streptococcus phage Javan140, complete genome 21994-22023 1 0.967
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MK448678 Streptococcus phage Javan135, complete genome 21899-21928 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 JX409894 Streptococcus phage LYGO9, complete genome 31161-31190 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MH853356 Streptococcus phage LF2, partial genome 1515-1544 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448971 Streptococcus phage Javan52, complete genome 17509-17538 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448829 Streptococcus phage Javan7, complete genome 14358-14387 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448736 Streptococcus phage Javan35, complete genome 14828-14857 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448956 Streptococcus phage Javan48, complete genome 16397-16426 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448781 Streptococcus phage Javan5, complete genome 16850-16879 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448749 Streptococcus phage Javan39, complete genome 16483-16512 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MH853355 Streptococcus phage LF1, complete genome 5215-5244 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448938 Streptococcus phage Javan44, complete genome 14829-14858 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448911 Streptococcus phage Javan34, complete genome 14828-14857 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448837 Streptococcus phage Javan10, complete genome 12886-12915 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448742 Streptococcus phage Javan37, complete genome 14664-14693 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MH853358 Streptococcus phage LF4, complete genome 5215-5244 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448851 Streptococcus phage Javan14, complete genome 16770-16799 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448916 Streptococcus phage Javan36, complete genome 14828-14857 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448673 Streptococcus phage Javan119, complete genome 16121-16150 1 0.967
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448796 Streptococcus phage Javan53, complete genome 19246-19275 2 0.933
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448859 Streptococcus phage Javan170, complete genome 17030-17059 2 0.933
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448672 Streptococcus phage Javan117, complete genome 12142-12171 2 0.933
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448686 Streptococcus phage Javan157, complete genome 16294-16323 2 0.933
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448854 Streptococcus phage Javan146, complete genome 17049-17078 2 0.933
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448676 Streptococcus phage Javan131, complete genome 19550-19579 2 0.933
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 MK448688 Streptococcus phage Javan161, complete genome 16983-17012 2 0.933
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 MK448761 Streptococcus phage Javan445, complete genome 17698-17727 2 0.933
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 MK448760 Streptococcus phage Javan443, complete genome 17698-17727 2 0.933
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 MK448971 Streptococcus phage Javan52, complete genome 11833-11862 2 0.933
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 MH853356 Streptococcus phage LF2, partial genome 8570-8599 2 0.933
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 MK448761 Streptococcus phage Javan445, complete genome 17700-17724 2 0.92
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 MK448760 Streptococcus phage Javan443, complete genome 17700-17724 2 0.92
NZ_CP025028_1 1.5|513944|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513944-513977 34 MK449012 Streptococcus phage Javan94, complete genome 33617-33650 3 0.912
NZ_CP025028_1 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 514077-514110 34 MK448796 Streptococcus phage Javan53, complete genome 38885-38918 3 0.912
NZ_CP025028_1 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 514077-514110 34 MK448742 Streptococcus phage Javan37, complete genome 30083-30116 3 0.912
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 24103-24127 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 54846-54870 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019919 Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019920 Borreliella burgdorferi strain PAbe plasmid p_cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 30795-30819 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 61101-61125 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP018755 Borreliella garinii strain CIP 103362 isolate 20047 plasmid cp32, complete sequence 32-56 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_018980 Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_018984 Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_019003 Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_019004 Borrelia burgdorferi 297 plasmid 297_cp32-11, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_019006 Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017427 Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017428 Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017398 Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017424 Borreliella burgdorferi N40 plasmid N40_cp32-10, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017402 Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017423 Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence 145-169 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017400 Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017393 Borreliella burgdorferi JD1 plasmid JD1 cp32-11, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 30782-30806 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017396 Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017397 Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP031406 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence 79-103 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP031408 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence 19759-19783 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP031411 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence 17382-17406 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_011722 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP028864 Borreliella garinii strain 20047 plasmid cp32-3, complete sequence 21050-21074 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP028868 Borreliella garinii strain 20047 plasmid cp32-6, complete sequence 29033-29057 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP028875 Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence 8744-8768 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP028880 Borreliella bavariensis PBi plasmid cp32-5, complete sequence 25535-25559 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP028881 Borreliella bavariensis PBi plasmid cp32-7, complete sequence 19863-19887 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_000948 Borreliella burgdorferi B31 plasmid cp32-1, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_000949 Borreliella burgdorferi B31 plasmid cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_000951 Borreliella burgdorferi B31 plasmid cp32-6, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_000954 Borreliella burgdorferi B31 plasmid cp32-9, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP015799 Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP015800 Borrelia mayonii strain MN14-1539 plasmid cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP015801 Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP015802 Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence 158-182 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019846 Borreliella burgdorferi plasmid cp32-1, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019847 Borreliella burgdorferi plasmid cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019848 Borreliella burgdorferi plasmid cp32-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019849 Borreliella burgdorferi plasmid cp32-5, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019850 Borreliella burgdorferi plasmid cp32-9, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 143-167 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 30819-30843 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019757 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019758 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019759 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP019760 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP015798 Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_011731 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_011735 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NC_011736 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017204 Borreliella burgdorferi strain B331 plasmid B331_cp32_10, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017205 Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017206 Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017207 Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017208 Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP017209 Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.11|916360|25|NZ_CP025028|PILER-CR 916360-916384 25 NZ_CP015784 Borrelia mayonii strain MN14-1420 plasmid cp32-3, complete sequence 144-168 4 0.84
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 MH616653 Microviridae sp. isolate ctbj22, complete genome 4068-4092 4 0.84
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 MN693930 Marine virus AFVG_250M489, complete genome 24204-24228 4 0.84
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 72996-73027 5 0.844
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448729 Streptococcus phage Javan31, complete genome 18967-18996 5 0.833
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448691 Streptococcus phage Javan17, complete genome 18967-18996 5 0.833
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448948 Streptococcus phage Javan46, complete genome 18911-18940 5 0.833
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448768 Streptococcus phage Javan47, complete genome 20615-20644 5 0.833
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 MK448927 Streptococcus phage Javan394, complete genome 34012-34041 5 0.833
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448711 Streptococcus phage Javan235, complete genome 11955-11984 5 0.833
NZ_CP025028_2 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915961-915990 30 MK448702 Streptococcus phage Javan199, complete genome 6911-6940 5 0.833
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 NZ_AP019552 Athalassotoga saccharophila strain NAS-01 plasmid pATS1, complete sequence 1037-1061 5 0.8
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 418646-418670 5 0.8
NZ_CP025028_2 2.12|916426|25|NZ_CP025028|PILER-CR 916426-916450 25 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 128245-128269 5 0.8
NZ_CP025028_1 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513878-513911 34 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 606095-606128 6 0.824
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 548430-548461 6 0.812
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP038623 Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence 39364-39395 6 0.812
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_017421 Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence 28345-28376 6 0.812
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_001856 Borreliella burgdorferi B31 plasmid lp38, complete sequence 28055-28086 6 0.812
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP019853 Borreliella burgdorferi plasmid lp38, complete sequence 28068-28099 6 0.812
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP019764 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence 28061-28092 6 0.812
NZ_CP025028_2 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916027-916056 30 CP002962 Emticicia oligotrophica DSM 17448 plasmid pEMTOL01, complete sequence 1141-1170 6 0.8
NZ_CP025028_2 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916027-916056 30 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 349864-349893 6 0.8
NZ_CP025028_2 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916027-916056 30 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 464430-464459 6 0.8
NZ_CP025028_2 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916027-916056 30 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 326124-326153 6 0.8
NZ_CP025028_2 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916027-916056 30 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 29129-29158 6 0.8
NZ_CP025028_2 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916027-916056 30 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 29170-29199 6 0.8
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP018755 Borreliella garinii strain CIP 103362 isolate 20047 plasmid cp32, complete sequence 29-58 6 0.8
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP028864 Borreliella garinii strain 20047 plasmid cp32-3, complete sequence 21048-21077 6 0.8
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP028868 Borreliella garinii strain 20047 plasmid cp32-6, complete sequence 29031-29060 6 0.8
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP028875 Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence 8742-8771 6 0.8
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP028880 Borreliella bavariensis PBi plasmid cp32-5, complete sequence 25532-25561 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NZ_LR214985 Mycoplasma cynos strain NCTC10142 plasmid 12 302-331 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NZ_LR214985 Mycoplasma cynos strain NCTC10142 plasmid 12 3245-3274 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 859383-859412 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MN693696 Marine virus AFVG_250M1082, complete genome 16296-16325 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MN694110 Marine virus AFVG_250M1083, complete genome 23267-23296 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MN694066 Marine virus AFVG_250M1081, complete genome 16277-16306 6 0.8
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 MN693930 Marine virus AFVG_250M489, complete genome 24202-24231 6 0.8
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP048628 Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence 37661-37690 6 0.8
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_014633 Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence 484591-484622 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 AP014284 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS *** 9262-9293 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 46517-46548 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 131643-131674 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 15273-15304 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 232837-232868 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 25057-25088 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 158727-158758 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 158558-158589 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 1638-1669 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_020380 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence 13185-13216 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 MH517022 Acinetobacter phage SH-Ab 15599, complete genome 51037-51068 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 MK496784 Capybara microvirus Cap3_SP_414, complete genome 2372-2403 7 0.781
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 U72945 Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region 829-860 7 0.781
NZ_CP025028_2 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT 916225-916254 30 MK448761 Streptococcus phage Javan445, complete genome 17825-17854 7 0.767
NZ_CP025028_2 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT 916225-916254 30 MK448760 Streptococcus phage Javan443, complete genome 17825-17854 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 24101-24130 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 54844-54873 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019919 Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019920 Borreliella burgdorferi strain PAbe plasmid p_cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 30793-30822 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 61099-61128 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_018980 Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_018984 Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_019003 Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_019004 Borrelia burgdorferi 297 plasmid 297_cp32-11, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_019006 Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017427 Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017428 Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017398 Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017424 Borreliella burgdorferi N40 plasmid N40_cp32-10, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017402 Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017423 Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence 143-172 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017400 Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017393 Borreliella burgdorferi JD1 plasmid JD1 cp32-11, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 30780-30809 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017396 Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017397 Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP031406 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence 77-106 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP031408 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence 19757-19786 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP031411 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence 17380-17409 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_011722 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP028881 Borreliella bavariensis PBi plasmid cp32-7, complete sequence 19861-19890 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_000948 Borreliella burgdorferi B31 plasmid cp32-1, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_000949 Borreliella burgdorferi B31 plasmid cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_000951 Borreliella burgdorferi B31 plasmid cp32-6, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_000954 Borreliella burgdorferi B31 plasmid cp32-9, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP015799 Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP015800 Borrelia mayonii strain MN14-1539 plasmid cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP015801 Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP015802 Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence 156-185 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019846 Borreliella burgdorferi plasmid cp32-1, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019847 Borreliella burgdorferi plasmid cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019848 Borreliella burgdorferi plasmid cp32-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019849 Borreliella burgdorferi plasmid cp32-5, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019850 Borreliella burgdorferi plasmid cp32-9, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 141-170 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 30817-30846 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019757 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019758 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019759 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP019760 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP015798 Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_011731 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_011735 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NC_011736 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017204 Borreliella burgdorferi strain B331 plasmid B331_cp32_10, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017205 Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017206 Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017207 Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017208 Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP017209 Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 NZ_CP015784 Borrelia mayonii strain MN14-1420 plasmid cp32-3, complete sequence 142-171 7 0.767
NZ_CP025028_2 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT 916357-916386 30 MN034827 Leviviridae sp. isolate H4_Bulk_46_scaffold_544 RNA-dependent RNA polymerase (H4Bulk46544_000001), hypothetical protein (H4Bulk46544_000002), hypothetical protein (H4Bulk46544_000003), and hypothetical protein (H4Bulk46544_000004) genes, complete cds 16-45 7 0.767
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 CP016196 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence 21697-21726 7 0.767
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 418643-418672 7 0.767
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 128243-128272 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP028227 Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence 51262-51291 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 30677-30706 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP025691 Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence 40808-40837 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP021502 Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence 61827-61856 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP016271 Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence 4598-4627 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP024060 Lactobacillus plantarum strain KACC 92189 plasmid unnamed2 49470-49499 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP032360 Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence 31271-31300 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP023303 Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence 54034-54063 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP032643 Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence 47790-47819 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP035146 Lactobacillus plantarum strain SRCM103357 plasmid unnamed3 20183-20212 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP028262 Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence 25708-25737 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP048024 Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence 9371-9400 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP028223 Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence 57371-57400 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP028276 Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence 44739-44768 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP028244 Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence 33926-33955 7 0.767
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP054261 Lactobacillus plantarum strain TCI507 plasmid unnamed2 19083-19112 7 0.767
NZ_CP025028_3 3.5|1955110|42|NZ_CP025028|CRT 1955110-1955151 42 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 39878-39919 7 0.833
NZ_CP025028_3 3.5|1955110|42|NZ_CP025028|CRT 1955110-1955151 42 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 225328-225369 7 0.833
NZ_CP025028_3 3.7|1955206|30|NZ_CP025028|CRT 1955206-1955235 30 NC_048797 Bacillus phage vB_BmeM-Goe8, complete genome 33780-33809 7 0.767
NZ_CP025028_1 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513878-513911 34 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 617393-617426 8 0.765
NZ_CP025028_1 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513878-513911 34 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 378878-378911 8 0.765
NZ_CP025028_1 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513878-513911 34 NC_015901 Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence 18325-18358 8 0.765
NZ_CP025028_1 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT 514210-514243 34 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 42532-42565 8 0.765
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP029456 Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence 61423-61454 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 70696-70727 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 CP016196 Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence 62259-62290 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 70700-70731 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 70707-70738 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 70706-70737 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 MH830339 Proteus phage Stubb, complete genome 26806-26837 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 MG030347 Proteus phage PM135, complete genome 76557-76588 8 0.75
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 MN935203 UNVERIFIED: Proteus phage VTCCBPA139, partial genome 26007-26038 8 0.75
NZ_CP025028_2 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 915895-915924 30 NZ_CP045128 Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence 39244-39273 8 0.733
NZ_CP025028_2 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916093-916122 30 MT774391 CrAssphage cr126_1, complete genome 83244-83273 8 0.733
NZ_CP025028_2 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 916159-916188 30 JX409895 Streptococcus phage JX01, complete genome 43007-43028 8 0.733
NZ_CP025028_2 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT 916225-916254 30 NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 81599-81628 8 0.733
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 15093-15122 8 0.733
NZ_CP025028_2 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT 916423-916452 30 NC_048803 Proteus phage Myduc, complete genome 30046-30075 8 0.733
NZ_CP025028_2 2.10|916489|30|NZ_CP025028|CRT 916489-916518 30 NZ_CP035159 Lactobacillus plantarum strain SRCM103362 plasmid unnamed3 4094-4123 8 0.733
NZ_CP025028_1 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513878-513911 34 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 243737-243770 9 0.735
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 93170-93201 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 228972-229003 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_MG205643 Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence 9883-9914 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_AP017932 Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence 5632-5663 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP025208 Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence 12385-12416 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP021933 Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence 57054-57085 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP017376 Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence 17183-17214 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP021472 Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence 18052-18083 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP052067 Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence 1046-1077 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP031209 Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence 42073-42104 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP035015 Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence 24116-24147 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_003383 Listeria innocua Clip11262 plasmid pLI100, complete sequence 34563-34594 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP048005 Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence 41814-41845 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP046038 Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence 31384-31415 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP017410 Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence 12201-12232 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_016608 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence 15266-15297 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP029967 Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence 42716-42747 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP028336 Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence 38185-38216 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP028231 Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence 3683-3714 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP018183 Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence 17219-17250 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 MH937473 Streptococcus phage CHPC929, complete genome 34811-34842 9 0.719
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NC_010353 Streptococcus phage 858, complete genome 33013-33044 9 0.719
NZ_CP025028_3 3.7|1955206|30|NZ_CP025028|CRT 1955206-1955235 30 NC_011759 Yersinia pseudotuberculosis pGDT4 plasmid 35429-35458 9 0.7
NZ_CP025028_1 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT 514210-514243 34 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 3102-3135 10 0.706
NZ_CP025028_1 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT 514210-514243 34 CP029330 Clostridium beijerinckii isolate WB53 plasmid unnamed1 17601-17634 10 0.706
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 161310-161341 10 0.688
NZ_CP025028_1 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT 513878-513911 34 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 238853-238886 11 0.676
NZ_CP025028_1 1.10|514276|32|NZ_CP025028|CRT 514276-514307 32 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 90370-90401 11 0.656

1. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

2. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

3. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

4. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

5. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

6. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

7. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

8. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

9. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448708 (Streptococcus phage Javan23, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

10. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448897 (Streptococcus phage Javan28, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

11. spacer 1.1|513679|35|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

agaagattattacgttgagtccaagcctgacgtca	CRISPR spacer
agaagattattacgttgagtccaagcctgacgtca	Protospacer
***********************************

12. spacer 1.5|513944|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448932 (Streptococcus phage Javan42, complete genome) position: , mismatch: 0, identity: 1.0

aggcaaaagtcaacgagctactcaaacagccaaa	CRISPR spacer
aggcaaaagtcaacgagctactcaaacagccaaa	Protospacer
**********************************

13. spacer 1.8|514143|35|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

tagctgatagcctgcaatatacaaccatccgtttt	CRISPR spacer
tagctgatagcctgcaatatacaaccatccgtttt	Protospacer
***********************************

14. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

15. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

16. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

17. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448952 (Streptococcus phage Javan472, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

18. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

19. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

20. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

21. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

22. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

23. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

24. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

25. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448766 (Streptococcus phage Javan465, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

26. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

27. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

28. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

29. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

30. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

31. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

32. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

33. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

34. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

35. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

36. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

37. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccactagcatcacctaccaatct	Protospacer
******************************

38. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448965 (Streptococcus phage Javan506, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

39. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448959 (Streptococcus phage Javan488, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

40. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

41. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448949 (Streptococcus phage Javan460, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

42. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

43. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

44. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatgtctgtgctcaaca	Protospacer
******************************

45. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

46. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448784 (Streptococcus phage Javan505, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

47. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448952 (Streptococcus phage Javan472, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

48. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

49. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448947 (Streptococcus phage Javan458, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

50. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

51. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448961 (Streptococcus phage Javan494, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

52. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

53. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

54. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

55. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448766 (Streptococcus phage Javan465, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

56. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

57. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

58. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

59. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448689 (Streptococcus phage Javan163, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

60. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

61. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

62. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448974 (Streptococcus phage Javan524, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

63. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

64. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448789 (Streptococcus phage Javan513, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

65. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

66. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcgcttctgagtgttgattcatactcttta	Protospacer
******************************

67. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aaattctttgcttgattaattaattcgtct	Protospacer
******************************

68. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aaattctttgcttgattaattaattcgtct	Protospacer
******************************

69. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aaattctttgcttgattaattaattcgtct	Protospacer
******************************

70. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aaattctttgcttgattaattaattcgtct	Protospacer
******************************

71. spacer 2.10|916489|30|NZ_CP025028|CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
tcctctttctatgtttcaattgccaatttt	Protospacer
******************************

72. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 0, identity: 1.0

attctttgcttgattaattaattcg	CRISPR spacer
attctttgcttgattaattaattcg	Protospacer
*************************

73. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 0, identity: 1.0

attctttgcttgattaattaattcg	CRISPR spacer
attctttgcttgattaattaattcg	Protospacer
*************************

74. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 0, identity: 1.0

attctttgcttgattaattaattcg	CRISPR spacer
attctttgcttgattaattaattcg	Protospacer
*************************

75. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 0, identity: 1.0

attctttgcttgattaattaattcg	CRISPR spacer
attctttgcttgattaattaattcg	Protospacer
*************************

76. spacer 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.971

gtcgtaaagacgtagcatatcactaattagatca	CRISPR spacer
gtcgtaaagacgtagcatatcactaattaaatca	Protospacer
*****************************.****

77. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448852 (Streptococcus phage Javan140, complete genome) position: , mismatch: 1, identity: 0.967

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcacttctgagtgttgattcatactcttta	Protospacer
**.***************************

78. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448678 (Streptococcus phage Javan135, complete genome) position: , mismatch: 1, identity: 0.967

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
gcacttctgagtgttgattcatactcttta	Protospacer
**.***************************

79. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to JX409894 (Streptococcus phage LYGO9, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

80. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

81. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

82. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

83. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448736 (Streptococcus phage Javan35, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

84. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448956 (Streptococcus phage Javan48, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

85. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448781 (Streptococcus phage Javan5, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

86. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448749 (Streptococcus phage Javan39, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

87. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

88. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448938 (Streptococcus phage Javan44, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

89. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448911 (Streptococcus phage Javan34, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

90. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

91. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

92. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

93. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

94. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448916 (Streptococcus phage Javan36, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

95. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 1, identity: 0.967

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcacgttcgattcgtgatgggtctat	Protospacer
.*****************************

96. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
tcaatcacgttcgattcgtgatgggtctat	Protospacer
..****************************

97. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448859 (Streptococcus phage Javan170, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat	Protospacer
.*****.***********************

98. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat	Protospacer
.*****.***********************

99. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat	Protospacer
.*****.***********************

100. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat	Protospacer
.*****.***********************

101. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448676 (Streptococcus phage Javan131, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat	Protospacer
.*****.***********************

102. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448688 (Streptococcus phage Javan161, complete genome) position: , mismatch: 2, identity: 0.933

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
ttaatcgcgttcgattcgtgatgggtctat	Protospacer
.*****.***********************

103. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 2, identity: 0.933

aatattacattgataatgtagtagaattct	CRISPR spacer
aatattatattgataatgtagtagagttct	Protospacer
*******.*****************.****

104. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 2, identity: 0.933

aatattacattgataatgtagtagaattct	CRISPR spacer
aatattatattgataatgtagtagagttct	Protospacer
*******.*****************.****

105. spacer 2.10|916489|30|NZ_CP025028|CRT matches to MK448971 (Streptococcus phage Javan52, complete genome) position: , mismatch: 2, identity: 0.933

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
tcctctttctgtgtttcagttgccaatttt	Protospacer
**********.*******.***********

106. spacer 2.10|916489|30|NZ_CP025028|CRT matches to MH853356 (Streptococcus phage LF2, partial genome) position: , mismatch: 2, identity: 0.933

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
tcctctttctgtgtttcagttgccaatttt	Protospacer
**********.*******.***********

107. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 2, identity: 0.92

tattacattgataatgtagtagaat	CRISPR spacer
tattatattgataatgtagtagagt	Protospacer
*****.*****************.*

108. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 2, identity: 0.92

tattacattgataatgtagtagaat	CRISPR spacer
tattatattgataatgtagtagagt	Protospacer
*****.*****************.*

109. spacer 1.5|513944|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 3, identity: 0.912

aggcaaaagtcaacgagctactcaaacagccaaa	CRISPR spacer
aagcaaaagtcaacgagctactcaaacaaccaca	Protospacer
*.**************************.*** *

110. spacer 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448796 (Streptococcus phage Javan53, complete genome) position: , mismatch: 3, identity: 0.912

gtcgtaaagacgtagcatatcactaattagatca	CRISPR spacer
atcgtaaagacgtagcatatcactaattaagtca	Protospacer
.****************************..***

111. spacer 1.7|514077|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 3, identity: 0.912

gtcgtaaagacgtagcatatcactaattagatca	CRISPR spacer
gtcgtaaagacgtagcatatcactaattaagtcg	Protospacer
*****************************..**.

112. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

113. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

114. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

115. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

116. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019920 (Borreliella burgdorferi strain PAbe plasmid p_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

117. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

118. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

119. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

120. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP018755 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid cp32, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

121. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

122. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

123. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

124. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

125. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

126. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019004 (Borrelia burgdorferi 297 plasmid 297_cp32-11, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

127. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

128. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

129. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

130. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

131. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017424 (Borreliella burgdorferi N40 plasmid N40_cp32-10, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

132. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

133. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017423 (Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

134. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017400 (Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

135. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017393 (Borreliella burgdorferi JD1 plasmid JD1 cp32-11, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

136. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

137. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

138. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

139. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017397 (Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

140. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

141. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

142. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

143. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

144. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

145. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

146. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028864 (Borreliella garinii strain 20047 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

147. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028868 (Borreliella garinii strain 20047 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

148. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

149. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028880 (Borreliella bavariensis PBi plasmid cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

150. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

151. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

152. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000949 (Borreliella burgdorferi B31 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

153. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

154. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

155. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

156. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

157. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015800 (Borrelia mayonii strain MN14-1539 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

158. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

159. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

160. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

161. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019847 (Borreliella burgdorferi plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

162. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019848 (Borreliella burgdorferi plasmid cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

163. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

164. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

165. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

166. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

167. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

168. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019758 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

169. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019759 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

170. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

171. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

172. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

173. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

174. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

175. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

176. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017204 (Borreliella burgdorferi strain B331 plasmid B331_cp32_10, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

177. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

178. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

179. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017207 (Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

180. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

181. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

182. spacer 2.11|916360|25|NZ_CP025028|PILER-CR matches to NZ_CP015784 (Borrelia mayonii strain MN14-1420 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.84

tattacattgataatgtagtagaat	CRISPR spacer
aattacattgaaaatgtagcagaag	Protospacer
 ********** *******.**** 

183. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MH616653 (Microviridae sp. isolate ctbj22, complete genome) position: , mismatch: 4, identity: 0.84

attctttgcttgattaattaattcg	CRISPR spacer
attctttgcttgattaatttctttt	Protospacer
*******************  **. 

184. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to MN693930 (Marine virus AFVG_250M489, complete genome) position: , mismatch: 4, identity: 0.84

attctttgcttgattaattaattcg	CRISPR spacer
attatctgcttgattaattaatttt	Protospacer
*** *.*****************. 

185. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 5, identity: 0.844

taataatg-attatttttttattaattcattat	CRISPR spacer
-aaaactgtattatttttatataaattcattat	Protospacer
 ** * ** ********* *** **********

186. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448729 (Streptococcus phage Javan31, complete genome) position: , mismatch: 5, identity: 0.833

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgtccattagcatcacctacatttct	Protospacer
****** ***.*************   ***

187. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448691 (Streptococcus phage Javan17, complete genome) position: , mismatch: 5, identity: 0.833

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgtccattagcatcacctacatttct	Protospacer
****** ***.*************   ***

188. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448948 (Streptococcus phage Javan46, complete genome) position: , mismatch: 5, identity: 0.833

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgtccattagcatcacctacatttct	Protospacer
****** ***.*************   ***

189. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 5, identity: 0.833

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgtccattagcatcacctacatttct	Protospacer
****** ***.*************   ***

190. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448927 (Streptococcus phage Javan394, complete genome) position: , mismatch: 5, identity: 0.833

ttcttgaccactagcatcacct-accaatct	CRISPR spacer
ttcatgaccactagcatcatctaaataatc-	Protospacer
*** ***************.** * .**** 

191. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448711 (Streptococcus phage Javan235, complete genome) position: , mismatch: 5, identity: 0.833

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatatctgcgcactgca	Protospacer
****************.****.** * .**

192. spacer 2.2|915961|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MK448702 (Streptococcus phage Javan199, complete genome) position: , mismatch: 5, identity: 0.833

cttaatagtagatgatgtctgtgctcaaca	CRISPR spacer
cttaatagtagatgatatctgcgcactgca	Protospacer
****************.****.** * .**

193. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to NZ_AP019552 (Athalassotoga saccharophila strain NAS-01 plasmid pATS1, complete sequence) position: , mismatch: 5, identity: 0.8

attctttgcttgattaattaattcg	CRISPR spacer
tctctttgcttgattaattcattta	Protospacer
 .***************** ***..

194. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 5, identity: 0.8

attctttgcttgattaattaattcg	CRISPR spacer
gttttttgcttgattaattaatgtt	Protospacer
.**.****************** . 

195. spacer 2.12|916426|25|NZ_CP025028|PILER-CR matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 5, identity: 0.8

attctttgcttgattaattaattcg	CRISPR spacer
gttttttgcttgattaattaatgtt	Protospacer
.**.****************** . 

196. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

tattttatattaaaaataagactaccataattat-	CRISPR spacer
tattttatattgaaaataagaata-aataagaatg	Protospacer
***********.********* **  ****  ** 

197. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.812

taataatgattatttttttattaattcattat	CRISPR spacer
tattaatgattatttttttattagcaaatttt	Protospacer
** ********************..  *** *

198. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP038623 (Arsenophonus nasoniae strain FIN plasmid pArsFIN11, complete sequence) position: , mismatch: 6, identity: 0.812

taataatgattatttttttattaattcattat	CRISPR spacer
taataatgattatttagttattaacatataat	Protospacer
***************  *******. .** **

199. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_017421 (Borreliella burgdorferi N40 plasmid N40_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

taata-atgattatttttttattaattcattat	CRISPR spacer
-aatacctccttatttttttagttattcattat	Protospacer
 ****  *  *********** * *********

200. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_001856 (Borreliella burgdorferi B31 plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

taata-atgattatttttttattaattcattat	CRISPR spacer
-aatacctccttatttttttagttattcattat	Protospacer
 ****  *  *********** * *********

201. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP019853 (Borreliella burgdorferi plasmid lp38, complete sequence) position: , mismatch: 6, identity: 0.812

taata-atgattatttttttattaattcattat	CRISPR spacer
-aatacctccttatttttttagttattcattat	Protospacer
 ****  *  *********** * *********

202. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP019764 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp38, complete sequence) position: , mismatch: 6, identity: 0.812

taata-atgattatttttttattaattcattat	CRISPR spacer
-aatacctccttatttttttagttattcattat	Protospacer
 ****  *  *********** * *********

203. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to CP002962 (Emticicia oligotrophica DSM 17448 plasmid pEMTOL01, complete sequence) position: , mismatch: 6, identity: 0.8

caattataacaacaataaagtatgtaattc	CRISPR spacer
caaaagaatcaacaaaaaagtatgtaattc	Protospacer
***  . * ****** **************

204. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 6, identity: 0.8

caattataacaacaataaagtatgtaattc	CRISPR spacer
cccttttaacaacaatgaagtatgtactgc	Protospacer
*  ** **********.********* * *

205. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 6, identity: 0.8

caattataacaacaataaagtatgtaattc	CRISPR spacer
cccttttaacaacaatgaagtatgtactgc	Protospacer
*  ** **********.********* * *

206. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 6, identity: 0.8

caattataacaacaataaagtatgtaattc	CRISPR spacer
cccttttaacaacaatgaagtatgtactgc	Protospacer
*  ** **********.********* * *

207. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 6, identity: 0.8

caattataacaacaataaagtatgtaattc	CRISPR spacer
cccttttaacaacaatgaagtatgtactgc	Protospacer
*  ** **********.********* * *

208. spacer 2.3|916027|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 6, identity: 0.8

caattataacaacaataaagtatgtaattc	CRISPR spacer
cccttttaacaacaatgaagtatgtactgc	Protospacer
*  ** **********.********* * *

209. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP018755 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid cp32, complete sequence) position: , mismatch: 6, identity: 0.8

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagact	Protospacer
.* ********** *******.****  **

210. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028864 (Borreliella garinii strain 20047 plasmid cp32-3, complete sequence) position: , mismatch: 6, identity: 0.8

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagact	Protospacer
.* ********** *******.****  **

211. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028868 (Borreliella garinii strain 20047 plasmid cp32-6, complete sequence) position: , mismatch: 6, identity: 0.8

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagact	Protospacer
.* ********** *******.****  **

212. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 6, identity: 0.8

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagact	Protospacer
.* ********** *******.****  **

213. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028880 (Borreliella bavariensis PBi plasmid cp32-5, complete sequence) position: , mismatch: 6, identity: 0.8

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagact	Protospacer
.* ********** *******.****  **

214. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR214985 (Mycoplasma cynos strain NCTC10142 plasmid 12) position: , mismatch: 6, identity: 0.8

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aattcaattgcttgattaattaatttttct	Protospacer
** *.  ******************. ***

215. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR214985 (Mycoplasma cynos strain NCTC10142 plasmid 12) position: , mismatch: 6, identity: 0.8

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aattcaattgcttgattaattaatttttct	Protospacer
** *.  ******************. ***

216. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aattcaattgcttgattaattaatttttct	Protospacer
** *.  ******************. ***

217. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN693696 (Marine virus AFVG_250M1082, complete genome) position: , mismatch: 6, identity: 0.8

aaattct----ttgcttgattaattaattcgtct	CRISPR spacer
----tctacgattgcttgattaataaattcgttt	Protospacer
    ***    ************* *******.*

218. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN694110 (Marine virus AFVG_250M1083, complete genome) position: , mismatch: 6, identity: 0.8

aaattct----ttgcttgattaattaattcgtct	CRISPR spacer
----tctacgattgcttgattaataaattcgttt	Protospacer
    ***    ************* *******.*

219. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN694066 (Marine virus AFVG_250M1081, complete genome) position: , mismatch: 6, identity: 0.8

aaattct----ttgcttgattaattaattcgtct	CRISPR spacer
----tctacgattgcttgattaataaattcgttt	Protospacer
    ***    ************* *******.*

220. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN693930 (Marine virus AFVG_250M489, complete genome) position: , mismatch: 6, identity: 0.8

aaattctttgcttgattaattaattcgtct	CRISPR spacer
atattatctgcttgattaattaatttttgt	Protospacer
* *** *.*****************. * *

221. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP048628 (Megamonas funiformis strain JCM 14723 plasmid putative_Mfuni1, complete sequence) position: , mismatch: 6, identity: 0.8

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
gcctttttctatgtttaaattgcctaatct	Protospacer
 ***.*********** ******* * *.*

222. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.781

taataatgattatttttttattaattcattat-	CRISPR spacer
agataatgatttgttttttattaatat-ttata	Protospacer
 .*********  ************ . **** 

223. spacer 1.10|514276|32|NZ_CP025028|CRT matches to AP014284 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C63, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.781

taataatgattatttttttattaattcattat	CRISPR spacer
ttctaataattttttttttattaattctggat	Protospacer
*  ****.*** ***************   **

224. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaattccttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

225. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaattccttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

226. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaatttcttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

227. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaattccttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

228. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaattccttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

229. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaattccttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

230. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaatttcttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

231. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.781

taata-atgattatttttttattaattcattat	CRISPR spacer
-agtataaaattccttttttattaattcattag	Protospacer
 *.** * .*** .****************** 

232. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_020380 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-16, complete sequence) position: , mismatch: 7, identity: 0.781

--taataatgattatttttttattaattcattat	CRISPR spacer
cgtagtgtt--ttatttttttattaattatttat	Protospacer
  **.*. *  *****************  ****

233. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MH517022 (Acinetobacter phage SH-Ab 15599, complete genome) position: , mismatch: 7, identity: 0.781

taataatgattatttttttat--taattcattat	CRISPR spacer
taatagtgattatttttctattataatacgtc--	Protospacer
*****.***********.***  **** *.*.  

234. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MK496784 (Capybara microvirus Cap3_SP_414, complete genome) position: , mismatch: 7, identity: 0.781

taataatgattatttttttattaattcattat-	CRISPR spacer
tcgtaataatgatttttttattaatt-acgata	Protospacer
* .****.** *************** *. ** 

235. spacer 1.10|514276|32|NZ_CP025028|CRT matches to U72945 (Virus-like particle CAK1 of Clostridium beijerinckii origin of replication region) position: , mismatch: 7, identity: 0.781

-taataatgattatttttttattaattcattat	CRISPR spacer
tccataa-aattatttttttattaattgtttaa	Protospacer
 . **** .******************  *** 

236. spacer 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 7, identity: 0.767

gtcaaaagaaaaagattagtcatcacactg	CRISPR spacer
attggaggaagaagattagtcatcacattg	Protospacer
.*...*.***.****************.**

237. spacer 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 7, identity: 0.767

gtcaaaagaaaaagattagtcatcacactg	CRISPR spacer
attggaggaagaagattagtcatcacattg	Protospacer
.*...*.***.****************.**

238. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

239. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

240. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

241. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

242. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019920 (Borreliella burgdorferi strain PAbe plasmid p_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

243. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

244. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

245. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

246. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

247. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

248. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

249. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

250. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

251. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019004 (Borrelia burgdorferi 297 plasmid 297_cp32-11, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

252. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

253. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

254. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

255. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

256. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017424 (Borreliella burgdorferi N40 plasmid N40_cp32-10, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

257. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

258. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017423 (Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

259. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017400 (Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

260. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017393 (Borreliella burgdorferi JD1 plasmid JD1 cp32-11, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

261. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

262. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

263. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

264. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017397 (Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

265. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

266. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

267. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

268. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

269. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

270. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

271. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

272. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

273. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000949 (Borreliella burgdorferi B31 plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

274. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

275. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

276. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

277. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

278. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015800 (Borrelia mayonii strain MN14-1539 plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

279. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

280. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

281. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

282. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019847 (Borreliella burgdorferi plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

283. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019848 (Borreliella burgdorferi plasmid cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

284. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

285. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

286. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

287. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

288. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

289. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019758 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

290. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019759 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

291. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

292. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

293. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

294. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

295. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

296. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

297. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017204 (Borreliella burgdorferi strain B331 plasmid B331_cp32_10, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

298. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

299. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

300. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017207 (Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

301. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

302. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

303. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP015784 (Borrelia mayonii strain MN14-1420 plasmid cp32-3, complete sequence) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gaaattacattgaaaatgtagcagaagatt	Protospacer
.* ********** *******.****  .*

304. spacer 2.8|916357|30|NZ_CP025028|CRISPRCasFinder,CRT matches to MN034827 (Leviviridae sp. isolate H4_Bulk_46_scaffold_544 RNA-dependent RNA polymerase (H4Bulk46544_000001), hypothetical protein (H4Bulk46544_000002), hypothetical protein (H4Bulk46544_000003), and hypothetical protein (H4Bulk46544_000004) genes, complete cds) position: , mismatch: 7, identity: 0.767

aatattacattgataatgtagtagaattct	CRISPR spacer
gatattacatttataatgtaatagcggcct	Protospacer
.********** ********.*** . .**

305. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 7, identity: 0.767

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aaattttttgcttgataaattaatattttc	Protospacer
*****.********** ******* . *..

306. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 7, identity: 0.767

aaattctttgcttgattaattaattcgtct	CRISPR spacer
ttgttttttgcttgattaattaatgtttct	Protospacer
  .**.****************** . ***

307. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 7, identity: 0.767

aaattctttgcttgattaattaattcgtct	CRISPR spacer
ttgttttttgcttgattaattaatgtttct	Protospacer
  .**.****************** . ***

308. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028227 (Lactobacillus plantarum strain SRCM101187 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

309. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

310. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP025691 (Lactobacillus plantarum strain IRG1 plasmid pIRG101, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

311. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP021502 (Lactobacillus plantarum strain SRCM102022 plasmid pPL2022-1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

312. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP016271 (Lactobacillus plantarum subsp. plantarum strain CGMCC 1.557 plasmid pLp1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

313. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP024060 (Lactobacillus plantarum strain KACC 92189 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

314. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP032360 (Lactobacillus plantarum strain ZFM55 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

315. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP023303 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2602, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

316. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP032643 (Lactobacillus plantarum strain ZFM9 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

317. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP035146 (Lactobacillus plantarum strain SRCM103357 plasmid unnamed3) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

318. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028262 (Lactobacillus plantarum strain SRCM102737 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

319. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP048024 (Lactobacillus plantarum strain CACC 558 plasmid p2CACC558, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

320. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028223 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

321. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028276 (Lactobacillus plantarum strain SRCM100995 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

322. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP028244 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

323. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP054261 (Lactobacillus plantarum strain TCI507 plasmid unnamed2) position: , mismatch: 7, identity: 0.767

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaatata	Protospacer
. .************* * ******** * 

324. spacer 3.5|1955110|42|NZ_CP025028|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 7, identity: 0.833

taacgtctggtttaacttctggcttagcctctggtttggctt	CRISPR spacer
tagcaaccggtttaacttctggcttagcctctgccttggctg	Protospacer
**.*. *.************************* .****** 

325. spacer 3.5|1955110|42|NZ_CP025028|CRT matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 7, identity: 0.833

taacgtctggtttaacttctggcttagcctctggtttggctt	CRISPR spacer
tagcaaccggtttaacttctggcttagcctctgccttggctg	Protospacer
**.*. *.************************* .****** 

326. spacer 3.7|1955206|30|NZ_CP025028|CRT matches to NC_048797 (Bacillus phage vB_BmeM-Goe8, complete genome) position: , mismatch: 7, identity: 0.767

tagcttctggcttaacgtctggcttaacat	CRISPR spacer
ctgcttctggcttaacctctggctctgctt	Protospacer
. ************** *******. .* *

327. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.765

tattttatattaaaaataagactaccataattat	CRISPR spacer
gtgtttatattaaacataagactaacatttttgt	Protospacer
   *********** ********* ***  **.*

328. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.765

tattttat-attaaaaataagactaccataattat	CRISPR spacer
-gtaaaatgattaaaaataagactactttaatttt	Protospacer
 .*   ** *****************. ***** *

329. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_015901 (Lactococcus lactis subsp. lactis bv. diacetylactis plasmid pVF22, complete sequence) position: , mismatch: 8, identity: 0.765

tattttatattaaaaataagactaccataattat	CRISPR spacer
tattttatattaaaaattagaataatagaaatta	Protospacer
***************** *** ** .* ** *  

330. spacer 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 8, identity: 0.765

atcat-atctctataatttcctttcatatcaacgc	CRISPR spacer
-ttatgagtgctataatttccttttagatcaacga	Protospacer
 *.** * . **************.* ******* 

331. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP029456 (Bacillus cereus strain FORC087 plasmid pFORC087.2, complete sequence) position: , mismatch: 8, identity: 0.75

taataat-gattatttttttattaattcattat	CRISPR spacer
-agcattggattatttttctattaattaatttc	Protospacer
 *..* * **********.******** *** .

332. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaattcattat	CRISPR spacer
ttgttaatattattttttcattaatttattaa	Protospacer
* .* *  **********.*******.**** 

333. spacer 1.10|514276|32|NZ_CP025028|CRT matches to CP016196 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-2, complete sequence) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaattcattat	CRISPR spacer
tatattttattatttttttattagtttattaa	Protospacer
**    * ***************.**.**** 

334. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaattcattat	CRISPR spacer
ttgttaatattattttttcattaatttattaa	Protospacer
* .* *  **********.*******.**** 

335. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaattcattat	CRISPR spacer
ttgttaatattattttttcattaatttattaa	Protospacer
* .* *  **********.*******.**** 

336. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaattcattat	CRISPR spacer
ttgttaatattattttttcattaatttattaa	Protospacer
* .* *  **********.*******.**** 

337. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MH830339 (Proteus phage Stubb, complete genome) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaat-----tcattat	CRISPR spacer
ttattatgattatttatttattaataatgctc-----	Protospacer
* ** ********** *********     **     

338. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MG030347 (Proteus phage PM135, complete genome) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaat-----tcattat	CRISPR spacer
ttattatgattatttatttattaataatgctc-----	Protospacer
* ** ********** *********     **     

339. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MN935203 (UNVERIFIED: Proteus phage VTCCBPA139, partial genome) position: , mismatch: 8, identity: 0.75

taataatgattatttttttattaat-----tcattat	CRISPR spacer
ttattatgattatttatttattaataatgctc-----	Protospacer
* ** ********** *********     **     

340. spacer 2.1|915895|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045128 (Acinetobacter indicus strain XG03 plasmid pXG03-X3, complete sequence) position: , mismatch: 8, identity: 0.733

ttcttgaccactagcatcacctaccaatct	CRISPR spacer
ttcttgaccattagcatcatctacagtcgc	Protospacer
**********.********.**** . . .

341. spacer 2.4|916093|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to MT774391 (CrAssphage cr126_1, complete genome) position: , mismatch: 8, identity: 0.733

gcgcttctgagtgttgattcatactcttta	CRISPR spacer
aagcttctaagtgatgattcatactatact	Protospacer
. ******.**** *********** * . 

342. spacer 2.5|916159|30|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to JX409895 (Streptococcus phage JX01, complete genome) position: , mismatch: 8, identity: 0.733

ctaatcacgttcgattcgtgatgggtctat	CRISPR spacer
--------gttcgattcgtgatgggtctat	Protospacer
        **********************

343. spacer 2.6|916225|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.733

gtcaaaagaaaaagattagtcatcacactg	CRISPR spacer
ataaaaagaaaaagattagtcttcgaccaa	Protospacer
.* ****************** **.  * .

344. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 8, identity: 0.733

aaattctttgcttgattaattaattcgtct	CRISPR spacer
gtaacttttccttgattaattaattcttca	Protospacer
. * ..*** **************** ** 

345. spacer 2.9|916423|30|NZ_CP025028|CRISPRCasFinder,CRT matches to NC_048803 (Proteus phage Myduc, complete genome) position: , mismatch: 8, identity: 0.733

aaattctttgcttgattaattaattcgtct	CRISPR spacer
aaattctttgcttgcttcattaagcggaaa	Protospacer
************** ** ***** . *   

346. spacer 2.10|916489|30|NZ_CP025028|CRT matches to NZ_CP035159 (Lactobacillus plantarum strain SRCM103362 plasmid unnamed3) position: , mismatch: 8, identity: 0.733

tcctctttctatgtttcaattgccaatttt	CRISPR spacer
cattctttctatgtttaatttgccaataac	Protospacer
. .************* * ********  .

347. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.735

tattttata------ttaaaaataagactaccataattat	CRISPR spacer
------ataaacactttaaaaataatactacaataattaa	Protospacer
      ***      ********** ***** ******* 

348. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
ctcctaaatttatttttttataaattcattat	Protospacer
.  . * . ************ **********

349. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
ctcctaaatttatttttttataaattcattat	Protospacer
.  . * . ************ **********

350. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
agataatgattacttttatattaatagttttg	Protospacer
 .**********.**** *******   **  

351. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_AP017932 (Lactobacillus sakei strain LK-145 plasmid pLs145-a, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

352. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP025208 (Lactobacillus sakei strain WiKim0074 plasmid pLSW74_2, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

353. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP021933 (Lactobacillus plantarum strain TMW 1.1478 plasmid pL11478-1, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

354. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP017376 (Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

355. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP021472 (Pediococcus pentosaceus strain SRCM100892 plasmid pPC892-2, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

356. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP052067 (Lactobacillus paracasei strain 347-16 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

357. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP031209 (Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_A, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

358. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP035015 (Lactobacillus plantarum strain 12_3 plasmid pldC, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

359. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttatta-attcattat	CRISPR spacer
taataatgataatttttttgttacacctgcca-	Protospacer
********** ********.*** *......* 

360. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP048005 (Lactobacillus paracasei strain CACC 566 plasmid p2CACC566, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

361. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP046038 (Lactobacillus sakei strain CBA3614 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

362. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP017410 (Lactobacillus plantarum strain RI-113 plasmid pRI113_4, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

363. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_016608 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-5, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

364. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP029967 (Lactobacillus curvatus strain ZJUNIT8 plasmid pnunamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

365. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP028336 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

366. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP028231 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

367. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP018183 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-3, complete sequence) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
caataatcattgtttttttattaaattgggtt	Protospacer
.****** ***.************ *..   *

368. spacer 1.10|514276|32|NZ_CP025028|CRT matches to MH937473 (Streptococcus phage CHPC929, complete genome) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
tttacttacttacttttttattaattcaatat	Protospacer
*     *. ***.*************** ***

369. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NC_010353 (Streptococcus phage 858, complete genome) position: , mismatch: 9, identity: 0.719

taataatgattatttttttattaattcattat	CRISPR spacer
tttacttacttacttttttattaattcaatat	Protospacer
*     *. ***.*************** ***

370. spacer 3.7|1955206|30|NZ_CP025028|CRT matches to NC_011759 (Yersinia pseudotuberculosis pGDT4 plasmid) position: , mismatch: 9, identity: 0.7

tagcttctggcttaacgtctggcttaacat	CRISPR spacer
ggccggactgcttagcgtctggcttaacat	Protospacer
 . *   . *****.***************

371. spacer 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

atcatatctctataatttcctttcatatcaacgc	CRISPR spacer
cttatatctttataattttctttcatatagtttg	Protospacer
 *.******.********.********* . .  

372. spacer 1.9|514210|34|NZ_CP025028|CRISPRCasFinder,CRT matches to CP029330 (Clostridium beijerinckii isolate WB53 plasmid unnamed1) position: , mismatch: 10, identity: 0.706

atcatatctctataatttcctttcatatcaacgc	CRISPR spacer
cttatatctttataattttctttcatatagtttg	Protospacer
 *.******.********.********* . .  

373. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.688

taataatgattatttttttattaattcattat	CRISPR spacer
aagggtagattattttttcatttattcatttc	Protospacer
 *. .  ***********.*** ******* .

374. spacer 1.4|513878|34|NZ_CP025028|PILER-CR,CRISPRCasFinder,CRT matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 11, identity: 0.676

tattttatattaaaaataagactaccataattat	CRISPR spacer
tattttatattaaaaataaaattagtggtgaaaa	Protospacer
*******************.*.** ..  .  * 

375. spacer 1.10|514276|32|NZ_CP025028|CRT matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 11, identity: 0.656

taataatgattatttttttattaattcattat	CRISPR spacer
cccatttgaatatttatttattaattcatcta	Protospacer
.     *** ***** *************.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17140 : 29205 8 Microbacterium_phage(14.29%) NA NA
DBSCAN-SWA_2 81733 : 128082 61 Streptococcus_phage(57.69%) holin,terminase,integrase,tail,portal attL 81636:81653|attR 122266:122283
DBSCAN-SWA_3 607445 : 614999 11 Streptococcus_phage(50.0%) transposase,integrase attL 600790:600805|attR 618277:618292
DBSCAN-SWA_4 1145424 : 1295395 152 Streptococcus_phage(60.53%) capsid,protease,transposase,holin,tRNA,terminase,integrase,tail,portal attL 1244552:1244570|attR 1285634:1285652
DBSCAN-SWA_5 1542648 : 1553378 13 Streptococcus_phage(83.33%) NA NA
DBSCAN-SWA_6 2043801 : 2058365 22 Streptococcus_phage(66.67%) integrase attL 2041836:2041855|attR 2055768:2055787
DBSCAN-SWA_7 2066685 : 2073889 8 uncultured_Caudovirales_phage(16.67%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP025028.1|WP_000384271.1|260649_260976_+|replication-initiator-protein-A 260649_260976_+ 108 aa aa 63 NA NA No NA
NZ_CP025028.1|WP_000648621.1|2049855_2050098_-|hypothetical-protein 2049855_2050098_- 80 aa aa NA NA NA 2043801-2058365 yes