Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025036 Escherichia coli strain S17-20 chromosome, complete genome 5 crisprs csa3,RT,cas3,WYL,DEDDh,DinG,c2c9_V-U4,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 0 6 11 0

Results visualization

1. NZ_CP025036
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025036_1 151967-152106 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025036_2 1421563-1421712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025036_3 1691989-1692104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025036_4 1901831-1901984 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025036_5 4798807-4799201 Unclear I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP025036_4 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder 1901884-1901931 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
NZ_CP025036_4 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder 1901884-1901931 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
NZ_CP025036_4 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder 1901884-1901931 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
NZ_CP025036_4 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder 1901884-1901931 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
NZ_CP025036_1 1.1|152016|42|NZ_CP025036|CRISPRCasFinder 152016-152057 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
NZ_CP025036_5 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT 4798897-4798928 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
NZ_CP025036_1 1.1|152016|42|NZ_CP025036|CRISPRCasFinder 152016-152057 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
NZ_CP025036_5 5.3|4798958|32|NZ_CP025036|CRISPRCasFinder,CRT 4798958-4798989 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51275-51307 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45715-45747 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51275-51307 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45715-45747 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51275-51307 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51275-51307 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51275-51307 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29014-29046 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78291-78323 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18559-18591 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49239-49271 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81433-81465 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28915-28947 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36181-36213 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32229-32261 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39595 8 0.758
NZ_CP025036_5 5.8|4798897|33|NZ_CP025036|PILER-CR 4798897-4798929 33 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51934 8 0.758
NZ_CP025036_1 1.1|152016|42|NZ_CP025036|CRISPRCasFinder 152016-152057 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
NZ_CP025036_5 5.6|4799141|32|NZ_CP025036|CRISPRCasFinder,CRT 4799141-4799172 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688

1. spacer 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

2. spacer 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

3. spacer 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

4. spacer 4.1|1901884|48|NZ_CP025036|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tttacgccgcatccggcggttatgcgcagatgcctgatgcgacgctga	CRISPR spacer
tttatgccgcatccggcagttatgcgcagatgcctgatgcgacgctgg	Protospacer
****.************.*****************************.

5. spacer 1.1|152016|42|NZ_CP025036|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
gcgtaggccagataaggcgtttacgccgcatccggcatttgt	Protospacer
.******.*********.****************.*  .***

6. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

7. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

8. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

9. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

10. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

11. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

12. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

13. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

14. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

15. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

16. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

17. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

18. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

19. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

20. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

21. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

22. spacer 5.2|4798897|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

23. spacer 1.1|152016|42|NZ_CP025036|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaat	Protospacer
 .*******.*******.******************  * .*

24. spacer 5.3|4798958|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

25. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

26. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

27. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

28. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

29. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

30. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

31. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

32. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

33. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

34. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

35. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

36. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

37. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

38. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

39. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

40. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

41. spacer 5.8|4798897|33|NZ_CP025036|PILER-CR matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 8, identity: 0.758

--gccgtctgcctccagcccagccctggatatttc	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacgt	Protospacer
  ***  ****** ****.************ . .

42. spacer 1.1|152016|42|NZ_CP025036|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaac	Protospacer
 .*******.*******.******************  * ..

43. spacer 5.6|4799141|32|NZ_CP025036|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

actaaacttaatgatggccgttacagcgtgga	CRISPR spacer
gagtaacttaatgatgggcgtcacagcagcgg	Protospacer
.   ************* ***.*****.  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 660665 : 685172 31 Morganella_phage(27.78%) transposase,integrase attL 653722:653736|attR 678646:678660
DBSCAN-SWA_2 1395266 : 1448056 51 Vibrio_phage(23.08%) transposase,tRNA,integrase,holin,protease attL 1412319:1412334|attR 1438435:1438450
DBSCAN-SWA_3 1875130 : 1922948 44 Streptococcus_phage(25.0%) transposase,plate,capsid NA
DBSCAN-SWA_4 3048472 : 3103690 72 Escherichia_phage(82.26%) tail,tRNA,terminase,holin,lysis NA
DBSCAN-SWA_5 3309840 : 3364516 74 Enterobacteria_phage(36.0%) transposase,tail,head,terminase,portal,integrase,lysis,capsid attL 3336783:3336798|attR 3369212:3369227
DBSCAN-SWA_6 3935170 : 3944611 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_7 4341185 : 4389126 52 Escherichia_phage(43.75%) tail,holin,terminase,integrase attL 4339447:4339463|attR 4390182:4390198
DBSCAN-SWA_8 4451656 : 4537127 102 Enterobacteria_phage(77.19%) tail,tRNA,terminase,portal,holin,protease,integrase,plate,capsid attL 4462793:4462809|attR 4540794:4540810
DBSCAN-SWA_9 4546571 : 4663013 116 Enterobacteria_phage(56.06%) transposase,tail,head,terminase,portal,holin,protease,integrase,plate,capsid attL 4602237:4602255|attR 4617559:4617577
DBSCAN-SWA_10 4752410 : 4765593 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_11 5095840 : 5107122 10 Stx2-converting_phage(42.86%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage