Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025051 Pseudomonas aeruginosa strain PB353 chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,WYL,RT,DinG 0 1 7 2
NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 0 crisprs NA 0 0 0 3

Results visualization

1. NZ_CP025051
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025051_1 339291-339404 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025051_2 1948320-1948421 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP025051_2 2.1|1948345|52|NZ_CP025051|CRISPRCasFinder 1948345-1948396 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 2.1|1948345|52|NZ_CP025051|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 622161 : 744018 130 Pseudomonas_phage(53.85%) lysis,plate,portal,tRNA,head,capsid,tail,terminase NA
DBSCAN-SWA_2 1240916 : 1277431 39 uncultured_Caudovirales_phage(38.1%) portal,tRNA,protease,head,integrase,terminase,holin attL 1250980:1250997|attR 1273961:1273978
DBSCAN-SWA_3 1284074 : 1301351 17 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_4 1523616 : 1532645 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 2647736 : 2654630 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_6 3438565 : 3497143 81 Pseudomonas_phage(75.0%) portal,protease,head,capsid,integrase,tail,terminase,holin attL 3436057:3436072|attR 3496870:3496885
DBSCAN-SWA_7 4791593 : 4883927 113 Pseudomonas_phage(69.86%) tRNA,portal,protease,head,capsid,integrase,tail,terminase,holin attL 4824366:4824385|attR 4887676:4887695
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP025051.1|WP_100882745.1|3439222_3439525_+|hypothetical-protein 3439222_3439525_+ 100 aa aa 90 NA NA 3438565-3497143 NA
NZ_CP025051.1|WP_157814488.1|3439524_3439701_+|hypothetical-protein 3439524_3439701_+ 58 aa aa 91 NA NA 3438565-3497143 NA
2. NZ_CP025052
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP025052.1|WP_023131919.1|6676_6979_+|anti-CRISPR-protein-AcrE1 6676_6979_+ 100 aa aa 15 NA NA No NA
NZ_CP025052.1|WP_100882994.1|7001_7433_+|anti-CRISPR-protein-AcrF3 7001_7433_+ 143 aa aa 3 NA NA No NA
NZ_CP025052.1|WP_100882995.1|7429_7669_+|anti-CRISPR-protein 7429_7669_+ 79 aa aa 4 NA NA No NA