Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP015527 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 plasmid pSJTUF10984, complete sequence 0 crisprs cas14j 0 0 1 0
NZ_CP015526 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF10984 chromosome, complete genome 2 crisprs WYL,DinG,DEDDh,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 15 8 0

Results visualization

1. NZ_CP015527
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36506 : 43414 8 Escherichia_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP015526
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015526_1 2894868-2895384 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP015526_2 2911536-2912175 TypeI-E I-E
10 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP015526_2 2.5|2911809|33|NZ_CP015526|CRISPRCasFinder,CRT 2911809-2911841 33 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63435 4 0.879
NZ_CP015526_2 2.5|2911809|33|NZ_CP015526|CRISPRCasFinder,CRT 2911809-2911841 33 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91355-91387 4 0.879
NZ_CP015526_2 2.14|2911809|35|NZ_CP015526|PILER-CR 2911809-2911843 35 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63437 5 0.857
NZ_CP015526_2 2.14|2911809|35|NZ_CP015526|PILER-CR 2911809-2911843 35 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91353-91387 5 0.857
NZ_CP015526_2 2.15|2911871|34|NZ_CP015526|PILER-CR 2911871-2911904 34 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18967-19000 5 0.853
NZ_CP015526_2 2.15|2911871|34|NZ_CP015526|PILER-CR 2911871-2911904 34 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25136-25169 5 0.853
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18969-19000 6 0.812
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25138-25169 6 0.812
NZ_CP015526_2 2.15|2911871|34|NZ_CP015526|PILER-CR 2911871-2911904 34 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31716-31749 6 0.824
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31718-31749 7 0.781
NZ_CP015526_2 2.3|2911687|32|NZ_CP015526|CRISPRCasFinder,CRT 2911687-2911718 32 MN694003 Marine virus AFVG_250M677, complete genome 17629-17660 8 0.75
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP053022 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence 329022-329053 8 0.75
NZ_CP015526_2 2.8|2911993|32|NZ_CP015526|CRISPRCasFinder,CRT 2911993-2912024 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
NZ_CP015526_2 2.8|2911993|32|NZ_CP015526|CRISPRCasFinder,CRT 2911993-2912024 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
NZ_CP015526_2 2.12|2911687|34|NZ_CP015526|PILER-CR 2911687-2911720 34 MN694003 Marine virus AFVG_250M677, complete genome 17627-17660 8 0.765
NZ_CP015526_1 1.1|2894897|32|NZ_CP015526|CRISPRCasFinder,CRT 2894897-2894928 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
NZ_CP015526_1 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT 2895019-2895050 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
NZ_CP015526_1 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT 2895019-2895050 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
NZ_CP015526_1 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT 2895019-2895050 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
NZ_CP015526_1 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT 2895019-2895050 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
NZ_CP015526_1 1.7|2895263|32|NZ_CP015526|CRISPRCasFinder,CRT 2895263-2895294 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
NZ_CP015526_1 1.9|2894899|32|NZ_CP015526|PILER-CR 2894899-2894930 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
NZ_CP015526_1 1.11|2895021|32|NZ_CP015526|PILER-CR 2895021-2895052 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
NZ_CP015526_1 1.11|2895021|32|NZ_CP015526|PILER-CR 2895021-2895052 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
NZ_CP015526_1 1.11|2895021|32|NZ_CP015526|PILER-CR 2895021-2895052 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
NZ_CP015526_1 1.11|2895021|32|NZ_CP015526|PILER-CR 2895021-2895052 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
NZ_CP015526_1 1.15|2895265|32|NZ_CP015526|PILER-CR 2895265-2895296 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
NZ_CP015526_2 2.5|2911809|33|NZ_CP015526|CRISPRCasFinder,CRT 2911809-2911841 33 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143783 9 0.727
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP048340 Escherichia coli strain 142 plasmid p142_C, complete sequence 2410-2441 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_LR130559 Escherichia coli strain MS14385 isolate MS14385 plasmid 5 41882-41913 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP020518 Escherichia coli strain 222 plasmid unnamed2, complete sequence 13450-13481 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP020497 Escherichia coli strain 103 plasmid unnamed2, complete sequence 37140-37171 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP040921 Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence 32060-32091 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 CP053252 Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence 19381-19412 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP042622 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence 2614-2645 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_LT985302 Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI 11943-11974 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP028194 Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence 15383-15414 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP024865 Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence 22646-22677 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 AP019710 Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome 4361-4392 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP024829 Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence 2221-2252 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP009861 Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence 2868-2899 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 CP025877 Escherichia coli strain 503458 plasmid p503458_49, complete sequence 18343-18374 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP023368 Escherichia coli strain 1428 plasmid p48, complete sequence 4914-4945 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP032259 Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence 23402-23433 9 0.719
NZ_CP015526_2 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT 2911871-2911902 32 NZ_CP037450 Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence 15851-15882 9 0.719
NZ_CP015526_2 2.8|2911993|32|NZ_CP015526|CRISPRCasFinder,CRT 2911993-2912024 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719
NZ_CP015526_2 2.10|2912115|32|NZ_CP015526|CRISPRCasFinder,CRT 2912115-2912146 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 405613-405644 9 0.719
NZ_CP015526_2 2.4|2911748|32|NZ_CP015526|CRISPRCasFinder,CRT 2911748-2911779 32 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 103231-103262 10 0.688
NZ_CP015526_2 2.10|2912115|32|NZ_CP015526|CRISPRCasFinder,CRT 2912115-2912146 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 699963-699994 10 0.688
NZ_CP015526_2 2.14|2911809|35|NZ_CP015526|PILER-CR 2911809-2911843 35 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143785 11 0.686

1. spacer 2.5|2911809|33|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 4, identity: 0.879

tcaggaacgcgcggcggaagagcttggtgtttg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatg	Protospacer
************.***************.  **

2. spacer 2.5|2911809|33|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 4, identity: 0.879

tcaggaacgcgcggcggaagagcttggtgtttg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatg	Protospacer
************.***************.  **

3. spacer 2.14|2911809|35|NZ_CP015526|PILER-CR matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 5, identity: 0.857

tcaggaacgcgcggcggaagagcttggtgtttgcg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatgcc	Protospacer
************.***************.  *** 

4. spacer 2.14|2911809|35|NZ_CP015526|PILER-CR matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 5, identity: 0.857

tcaggaacgcgcggcggaagagcttggtgtttgcg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatgcc	Protospacer
************.***************.  *** 

5. spacer 2.15|2911871|34|NZ_CP015526|PILER-CR matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 5, identity: 0.853

gctgcctttcccggagttccggcccct----aaattgg	CRISPR spacer
ggtgcctttcccggagttccggccccttctcaaa----	Protospacer
* *************************    ***    

6. spacer 2.15|2911871|34|NZ_CP015526|PILER-CR matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

gctgcctttcccggagttccggcccct----aaattgg	CRISPR spacer
ggtgcctttcccggagttccggccccttctcaaa----	Protospacer
* *************************    ***    

7. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 6, identity: 0.812

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
ggtgcctttcccggagttccggccccttctca	Protospacer
* *************************   . 

8. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
ggtgcctttcccggagttccggccccttctca	Protospacer
* *************************   . 

9. spacer 2.15|2911871|34|NZ_CP015526|PILER-CR matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.824

gctgcctttcccggagttccggcccct----aaattgg	CRISPR spacer
ggtgccttttccggagttccggccccttctcaaa----	Protospacer
* *******.*****************    ***    

10. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
ggtgccttttccggagttccggccccttctca	Protospacer
* *******.*****************   . 

11. spacer 2.3|2911687|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75

cgattctacggcaacaggccaggctgcgaccg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcg	Protospacer
 *    .********** ***********.**

12. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.75

gctgcctttcccggagttccggcccctaaatt---	CRISPR spacer
tatgcctttcccggctttccggccc---aactgac	Protospacer
  ************  *********   **.*   

13. spacer 2.8|2911993|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

14. spacer 2.8|2911993|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

15. spacer 2.12|2911687|34|NZ_CP015526|PILER-CR matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765

cgattctacggcaacaggccaggctgcgaccgcg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcgcg	Protospacer
 *    .********** ***********.****

16. spacer 1.1|2894897|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

tatttataagcgtgtcatctatgcaacccaac	CRISPR spacer
aatttataatcatgtcatctatgccataattc	Protospacer
 ******** *.************ *.    *

17. spacer 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

18. spacer 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

19. spacer 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

20. spacer 1.3|2895019|32|NZ_CP015526|CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

21. spacer 1.7|2895263|32|NZ_CP015526|CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

gagaatgctcatgcgcgtgagcgccatatatt	CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt	Protospacer
 ..**** ********** ********    *

22. spacer 1.9|2894899|32|NZ_CP015526|PILER-CR matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

tatttataagcgtgtcatctatgcaacccaac	CRISPR spacer
aatttataatcatgtcatctatgccataattc	Protospacer
 ******** *.************ *.    *

23. spacer 1.11|2895021|32|NZ_CP015526|PILER-CR matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

24. spacer 1.11|2895021|32|NZ_CP015526|PILER-CR matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

25. spacer 1.11|2895021|32|NZ_CP015526|PILER-CR matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

26. spacer 1.11|2895021|32|NZ_CP015526|PILER-CR matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

27. spacer 1.15|2895265|32|NZ_CP015526|PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

gagaatgctcatgcgcgtgagcgccatatatt	CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt	Protospacer
 ..**** ********** ********    *

28. spacer 2.5|2911809|33|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

tcaggaacgcgcggcggaagagcttggtgtttg	CRISPR spacer
ctttgcccgtgcggcggaagaccttggtgtttc	Protospacer
..  *  **.*********** ********** 

29. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP048340 (Escherichia coli strain 142 plasmid p142_C, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

30. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_LR130559 (Escherichia coli strain MS14385 isolate MS14385 plasmid 5) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

31. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP020518 (Escherichia coli strain 222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

32. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP020497 (Escherichia coli strain 103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

33. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP040921 (Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

34. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to CP053252 (Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

35. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP042622 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

36. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_LT985302 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

37. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP028194 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

38. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

39. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to AP019710 (Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

40. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

41. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP009861 (Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

42. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to CP025877 (Escherichia coli strain 503458 plasmid p503458_49, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

43. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP023368 (Escherichia coli strain 1428 plasmid p48, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

44. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP032259 (Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

45. spacer 2.6|2911871|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP037450 (Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

46. spacer 2.8|2911993|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
agcttattgacgaaaacggcacagacaccaaa	Protospacer
 * ********** ***.********    *.

47. spacer 2.10|2912115|32|NZ_CP015526|CRISPRCasFinder,CRT matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gaatctggagggcgacagcgcggtcgaccctg	Protospacer
*********** *.*********. .* .*. 

48. spacer 2.4|2911748|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaacatggaaacccctttaatgagagcaa	CRISPR spacer
ctaaaacatggaaaccactgtaatgacgaatc	Protospacer
 * ************* ** ****** ..   

49. spacer 2.10|2912115|32|NZ_CP015526|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gtggtcataggccatcagcgcggcgatatccc	Protospacer
* . ... ****** *********** ****.

50. spacer 2.14|2911809|35|NZ_CP015526|PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

tcaggaacgcgcggcggaagagcttggtgtttgcg	CRISPR spacer
ctttgcccgtgcggcggaagaccttggtgtttctc	Protospacer
..  *  **.*********** ********** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 868229 : 875542 7 Dickeya_phage(16.67%) protease,integrase attL 856967:856981|attR 875760:875774
DBSCAN-SWA_2 925917 : 987435 54 Salmonella_phage(23.53%) protease,tail,tRNA NA
DBSCAN-SWA_3 1159827 : 1175942 16 Salmonella_phage(30.77%) holin,lysis,tail,integrase attL 1159663:1159692|attR 1179284:1179313
DBSCAN-SWA_4 1400367 : 1416311 21 Escherichia_phage(62.5%) holin,tRNA NA
DBSCAN-SWA_5 1948498 : 1995994 60 Salmonella_phage(77.78%) holin,head,protease,plate,tail,integrase,portal,transposase,terminase,capsid attL 1993387:1993401|attR 1999713:1999727
DBSCAN-SWA_6 2110257 : 2119424 9 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_7 2186622 : 2195793 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_8 2432226 : 2438279 6 Salmonella_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage