Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025117 Olleya sp. Bg11-27 chromosome, complete genome 9 crisprs WYL,DEDDh,cas3,RT,cas3HD,csa3 1 0 1 0

Results visualization

1. NZ_CP025117
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_1 218932-219142 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_2 549492-549680 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_3 1004098-1004277 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_6 1006341-1006439 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_4 1005723-1005831 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_5 1005957-1006206 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_7 1345122-1345237 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_8 2920033-2920139 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025117_9 3129316-3129411 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP025117_7 7.1|1345159|42|NZ_CP025117|CRISPRCasFinder 1345159-1345200 42 NZ_CP025117.1 973577-973618 1 0.976
NZ_CP025117_7 7.1|1345159|42|NZ_CP025117|CRISPRCasFinder 1345159-1345200 42 NZ_CP025117.1 1093360-1093401 1 0.976

1. spacer 7.1|1345159|42|NZ_CP025117|CRISPRCasFinder matches to position: 973577-973618, mismatch: 1, identity: 0.976

tgctaaatttatatatgaattaacttcctttataaacatagg	CRISPR spacer
tgctaaatttatatatgaattaacttcctttacaaacatagg	Protospacer
********************************.*********

2. spacer 7.1|1345159|42|NZ_CP025117|CRISPRCasFinder matches to position: 1093360-1093401, mismatch: 1, identity: 0.976

tgctaaatttatatatgaattaacttcctttataaacatagg	CRISPR spacer
tgctaaatttatatatgaattaacttcctttacaaacatagg	Protospacer
********************************.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 734050 : 744242 11 Escherichia_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage