Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021384 Bifidobacterium breve strain NRBB01 chromosome, complete genome 4 crisprs cas3,WYL,c2c9_V-U4 1 0 1 0

Results visualization

1. NZ_CP021384
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021384_1 1342445-1342517 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021384_2 2008975-2009121 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021384_3 2130532-2130616 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021384_4 2159236-2159312 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP021384_2 2.1|2009000|36|NZ_CP021384|CRISPRCasFinder 2009000-2009035 36 NZ_CP021384.1 2010337-2010372 1 0.972

1. spacer 2.1|2009000|36|NZ_CP021384|CRISPRCasFinder matches to position: 2010337-2010372, mismatch: 1, identity: 0.972

tcaaagccaatgacagatatttaggaaaccaacccc	CRISPR spacer
tcaaagccaatgacagatatttaggaaatcaacccc	Protospacer
****************************.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1482326 : 1494338 15 Propionibacterium_phage(33.33%) head,portal,capsid,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage