Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021558 Bifidobacterium breve strain 215W447a chromosome, complete genome 4 crisprs cas3,c2c9_V-U4,WYL,cas14j,DEDDh,Cas14u_CAS-V,c2c10_CAS-V-U3,cas14k 2 0 3 0

Results visualization

1. NZ_CP021558
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021558_1 152124-152199 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021558_2 152280-152458 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021558_3 2319651-2319797 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021558_4 2484553-2484629 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP021558_3 3.1|2319676|36|NZ_CP021558|CRISPRCasFinder 2319676-2319711 36 NZ_CP021558.1 2321013-2321048 0 1.0
NZ_CP021558_3 3.2|2319737|36|NZ_CP021558|CRISPRCasFinder 2319737-2319772 36 NZ_CP021558.1 2321074-2321109 2 0.944

1. spacer 3.1|2319676|36|NZ_CP021558|CRISPRCasFinder matches to position: 2321013-2321048, mismatch: 0, identity: 1.0

tcaaagccaatgacagatatttaggaaaccaacccc	CRISPR spacer
tcaaagccaatgacagatatttaggaaaccaacccc	Protospacer
************************************

2. spacer 3.2|2319737|36|NZ_CP021558|CRISPRCasFinder matches to position: 2321074-2321109, mismatch: 2, identity: 0.944

actcacttagcgacagtaatttaggacgactgggat	CRISPR spacer
actcacttagcgacagcaacttaggacgactgggat	Protospacer
****************.**.****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1230763 : 1273871 57 Thermus_phage(20.0%) transposase,integrase attL 1224796:1224812|attR 1251937:1251953
DBSCAN-SWA_2 1350997 : 1380916 25 Lactobacillus_phage(28.57%) transposase NA
DBSCAN-SWA_3 1707334 : 1733246 38 Bifidobacterium_phage(30.0%) protease,portal,capsid,terminase,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage