Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019091 Xanthomonas oryzae pv. oryzae strain MAI134 chromosome, complete genome 1 crisprs WYL,DEDDh,cas3,csa3,DinG 0 1 24 0

Results visualization

1. NZ_CP019091
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019091_1 2032463-2032660 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019091_1 1.1|2032508|30|NZ_CP019091|PILER-CR 2032508-2032537 30 NC_049470 Arthrobacter phage TripleJ, complete genome 44380-44409 5 0.833
NZ_CP019091_1 1.1|2032508|30|NZ_CP019091|PILER-CR 2032508-2032537 30 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 702822-702851 7 0.767

1. spacer 1.1|2032508|30|NZ_CP019091|PILER-CR matches to NC_049470 (Arthrobacter phage TripleJ, complete genome) position: , mismatch: 5, identity: 0.833

gtgagcaggtcgactgccgtgggtgcggta	CRISPR spacer
gggcgcaggccgactgccgggggtgcggga	Protospacer
* * *****.********* ******** *

2. spacer 1.1|2032508|30|NZ_CP019091|PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.767

gtgagcaggtcgactgccgtgggtgcggta-	CRISPR spacer
gtgagcaggtcggctgcggtggg-gtgacga	Protospacer
************.**** ***** *.*... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 100357 : 175551 58 Staphylococcus_phage(33.33%) tRNA,protease,holin,integrase,transposase attL 150704:150721|attR 182502:182519
DBSCAN-SWA_2 230212 : 279690 35 Leptospira_phage(42.86%) integrase,transposase attL 243129:243145|attR 266598:266614
DBSCAN-SWA_3 322541 : 381861 47 Ralstonia_phage(62.5%) transposase NA
DBSCAN-SWA_4 481590 : 698617 159 Stenotrophomonas_phage(29.69%) tail,tRNA,plate,protease,portal,head,holin,capsid,integrase,transposase,terminase attL 520883:520927|attR 563875:563919
DBSCAN-SWA_5 750343 : 909654 117 Staphylococcus_phage(20.69%) tRNA,transposase NA
DBSCAN-SWA_6 1095353 : 1154951 49 Bacillus_phage(26.67%) protease,holin,transposase NA
DBSCAN-SWA_7 1165919 : 1229898 49 Ralstonia_phage(25.0%) protease,transposase NA
DBSCAN-SWA_8 1299193 : 1342924 30 Listeria_phage(16.67%) plate,transposase NA
DBSCAN-SWA_9 1425494 : 1495107 60 Ralstonia_phage(36.36%) transposase NA
DBSCAN-SWA_10 1574441 : 1666375 78 Staphylococcus_phage(26.32%) tRNA,transposase,protease NA
DBSCAN-SWA_11 1690531 : 1766491 54 Ralstonia_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_12 1831468 : 1841345 7 Micromonas_sp._RCC1109_virus(16.67%) tRNA NA
DBSCAN-SWA_13 2140335 : 2198526 48 Ralstonia_phage(33.33%) tRNA,transposase,protease NA
DBSCAN-SWA_14 2321718 : 2390562 61 Stenotrophomonas_phage(50.0%) capsid,plate,coat NA
DBSCAN-SWA_15 2641862 : 2730690 52 Leptospira_phage(14.29%) tRNA,protease,transposase NA
DBSCAN-SWA_16 2936161 : 2999321 48 Bacillus_phage(14.29%) transposase NA
DBSCAN-SWA_17 3006211 : 3082660 58 Lactococcus_phage(11.11%) tRNA,transposase,coat,protease NA
DBSCAN-SWA_18 3319667 : 3393819 67 Burkholderia_phage(16.67%) tail,protease,tRNA,portal,head,capsid,transposase,terminase NA
DBSCAN-SWA_19 3534982 : 3608564 57 Ralstonia_phage(18.18%) tRNA,transposase NA
DBSCAN-SWA_20 3751988 : 3816744 45 Staphylococcus_phage(18.18%) protease,transposase NA
DBSCAN-SWA_21 3950934 : 3957304 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_22 4279053 : 4354648 58 Staphylococcus_phage(25.0%) tRNA,transposase NA
DBSCAN-SWA_23 4453753 : 4622539 104 Ralstonia_phage(21.43%) tRNA,transposase NA
DBSCAN-SWA_24 4638244 : 4703766 47 Ralstonia_phage(35.29%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage