1. spacer 1.11|334216|27|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
2. spacer 1.11|334216|27|NZ_CP025605|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
3. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
4. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
5. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
6. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
7. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
8. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
9. spacer 5.16|927312|24|NZ_CP025605|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
10. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
11. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
12. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
13. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
14. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
15. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
16. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
17. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
18. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
19. spacer 8.5|2088409|24|NZ_CP025605|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
20. spacer 8.5|2088409|24|NZ_CP025605|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
21. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 3, identity: 0.889
caccggcggcaaaggcggcatgggcgg CRISPR spacer
taccggcggcaaaggcggcaacggcgg Protospacer
.******************* *****
22. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.889
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggcggcaaaggcggcattggcgg Protospacer
* .****************** *****
23. spacer 3.1|366475|27|NZ_CP025605|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
24. spacer 3.1|366475|27|NZ_CP025605|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
25. spacer 3.7|366871|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
26. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
27. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
28. spacer 5.10|927027|27|NZ_CP025605|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
29. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
30. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
31. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
32. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
33. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
34. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
35. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
36. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
37. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
38. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
39. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
40. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
41. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
42. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
43. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
44. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
45. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
46. spacer 5.16|927312|24|NZ_CP025605|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
47. spacer 8.5|2088409|24|NZ_CP025605|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
48. spacer 8.5|2088409|24|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
49. spacer 8.5|2088409|24|NZ_CP025605|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
50. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
51. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
52. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
53. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
54. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
55. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
56. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
acccggcggcaaaggcgcaatgggcgg Protospacer
*************** ********
57. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
58. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
59. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
60. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
61. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
62. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
63. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
64. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
65. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
66. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
67. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
68. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
69. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
70. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
71. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
72. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
73. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
74. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
75. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
76. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
77. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
78. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
79. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
80. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
81. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
82. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
83. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
84. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
85. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
86. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
87. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
88. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
89. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
90. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
91. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
92. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
93. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
94. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
95. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
96. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcgg-catgggcgg CRISPR spacer
caccggcggcaaaggcggccatcgaca- Protospacer
****************** *** *.*.
97. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcagaggcggcaagggcgg Protospacer
*. ********.******** ******
98. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
99. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
100. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
101. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
102. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
103. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
104. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
105. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
106. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcggcggcaagggcggcatggccgg Protospacer
*.*********.********** ***
107. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
108. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
109. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
110. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
111. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
112. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
113. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
114. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
115. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
116. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
117. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
118. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
119. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
120. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
121. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
122. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
123. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
124. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
125. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
126. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
127. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
128. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
129. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
130. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
131. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
132. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
133. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
134. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
135. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
136. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
137. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
138. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
139. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
140. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
141. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
142. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
143. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
144. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
145. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
146. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
147. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
148. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
149. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
150. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
151. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
152. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
153. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
154. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
155. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
156. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
157. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
158. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
159. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
160. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
161. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
162. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
163. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
164. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
165. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
166. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
167. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
168. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
169. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
170. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
171. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
172. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
173. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
174. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
175. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
176. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
177. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
178. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
179. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
180. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
181. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
182. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
183. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
184. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
185. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
186. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
187. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
188. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
189. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
190. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
191. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
192. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
193. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
194. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
195. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
196. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
197. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
198. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
199. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
200. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
201. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
202. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
203. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
204. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
205. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
206. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
207. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
208. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
209. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
210. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
211. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
212. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
213. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
214. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
215. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
216. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
217. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
218. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
219. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
220. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
221. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
222. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
223. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
224. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
225. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
226. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
227. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
228. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
229. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
230. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
231. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
232. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
233. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
234. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
235. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
236. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
237. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
238. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
239. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
240. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
241. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
242. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
243. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
244. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
245. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
246. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
247. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
248. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
249. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
250. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
251. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
252. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
253. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
254. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
255. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
256. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
257. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
258. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
259. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgcgggcggcacagccggcatgggcgg Protospacer
*.* ******* ** ************
260. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
261. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
262. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgcgggcggcaacggcggcaggggcgg Protospacer
*.* ******** ******* ******
263. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
264. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
265. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
266. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
267. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caagggcggcaagggcggcatcggcgg Protospacer
** ********.******** *****
268. spacer 1.2|333736|27|NZ_CP025605|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
269. spacer 1.11|334216|27|NZ_CP025605|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
270. spacer 1.11|334216|27|NZ_CP025605|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
271. spacer 1.11|334216|27|NZ_CP025605|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
272. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
273. spacer 1.12|334261|30|NZ_CP025605|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
274. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
275. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
276. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
277. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
278. spacer 3.1|366475|27|NZ_CP025605|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
279. spacer 3.1|366475|27|NZ_CP025605|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
280. spacer 3.7|366871|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
281. spacer 3.7|366871|27|NZ_CP025605|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
282. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
283. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
284. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
285. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
286. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
287. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
288. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
289. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
290. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
291. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
292. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
293. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
294. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
295. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
296. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
297. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
298. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
299. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
300. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
301. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
302. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
303. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
304. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
305. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
306. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
307. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
308. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
309. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
310. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
311. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
312. spacer 5.5|926817|27|NZ_CP025605|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
313. spacer 5.5|926817|27|NZ_CP025605|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
314. spacer 5.5|926817|27|NZ_CP025605|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
315. spacer 5.5|926817|27|NZ_CP025605|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
316. spacer 5.5|926817|27|NZ_CP025605|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
317. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
318. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
319. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
320. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
321. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
322. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
323. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
324. spacer 5.10|927027|27|NZ_CP025605|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
325. spacer 5.10|927027|27|NZ_CP025605|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
326. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
327. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
328. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
329. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
330. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
331. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
332. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
333. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
334. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
335. spacer 5.15|927264|30|NZ_CP025605|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
336. spacer 5.16|927312|24|NZ_CP025605|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
337. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
338. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
339. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
340. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
341. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
342. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
343. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
344. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
345. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
346. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
347. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
348. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
349. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggcggcaagagcgg Protospacer
. ***************** *.****
350. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
351. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaacgcggcctgggcgg Protospacer
. ********** ***** *******
352. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
353. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
354. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
355. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
356. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
357. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
358. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
aggcggcggcaaaggcggcaagggagg Protospacer
. ***************** *** **
359. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
360. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
361. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
362. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
363. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
364. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
365. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
366. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaagcggcctgggcgg Protospacer
. **********.***** *******
367. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggcggcggcatgggcggcatgggcgg Protospacer
.. ******** .**************
368. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgtcggcggcaatggcggcgtgggcgg Protospacer
...********* ******.*******
369. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
370. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gaccggcggcaatggcggcattggcct Protospacer
*********** ******** ***
371. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
372. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
373. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
374. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
375. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gaagggcggcaatggcggcatcggcgg Protospacer
* ******** ******** *****
376. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcacgggcct Protospacer
*.**********.*******.****
377. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
378. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
379. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
380. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatgggcggcaagggcggcaagggcgg Protospacer
*. ********.******* ******
381. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgacggcggcgaaggcggcacgggcgc Protospacer
*. *******.*********.*****
382. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tatgggcggcatgggcggcatgggcgg Protospacer
.*. ******* .**************
383. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
384. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
385. spacer 1.3|333781|30|NZ_CP025605|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
386. spacer 1.12|334261|30|NZ_CP025605|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
387. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
388. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
389. spacer 3.1|366475|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
390. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
391. spacer 3.7|366871|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
392. spacer 3.9|367021|27|NZ_CP025605|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
393. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
394. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
395. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
396. spacer 3.10|367081|27|NZ_CP025605|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
397. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
398. spacer 5.5|926817|27|NZ_CP025605|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
399. spacer 5.5|926817|27|NZ_CP025605|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
400. spacer 5.5|926817|27|NZ_CP025605|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
401. spacer 5.5|926817|27|NZ_CP025605|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
402. spacer 5.5|926817|27|NZ_CP025605|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
403. spacer 5.5|926817|27|NZ_CP025605|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
404. spacer 5.5|926817|27|NZ_CP025605|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
405. spacer 5.5|926817|27|NZ_CP025605|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
406. spacer 5.10|927027|27|NZ_CP025605|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
407. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
408. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
409. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
410. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
411. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
412. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
413. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
414. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
415. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
416. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
417. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
418. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
419. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
420. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
421. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
422. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
423. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
424. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
425. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
426. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
427. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
428. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
429. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
430. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
431. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
432. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
433. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
434. spacer 5.15|927264|30|NZ_CP025605|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
435. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
436. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
437. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
438. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
439. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
440. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
441. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
442. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
443. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
444. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
445. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
446. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
447. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
448. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
449. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
450. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
451. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
452. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
453. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
454. spacer 5.15|927264|30|NZ_CP025605|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
455. spacer 5.17|927354|36|NZ_CP025605|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
456. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
457. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
458. spacer 13.8|3948835|36|NZ_CP025605|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833
tagcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
. *** ***************** **** ******
459. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggccaaggcggcatcggcgc Protospacer
. ******* ********** ****
460. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
taccggcggcaaaggcggcatccacct Protospacer
.******************** .*
461. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcggcaacctctt Protospacer
******************** *
462. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
463. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgtgggcggcacaggcggcacgggcgg Protospacer
... ******* ********.******
464. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggccggcggcaatgtcggcatgggcac Protospacer
.********** * **********.
465. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggcggcgagggcga Protospacer
. ****************. *****.
466. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaggggcggcatggcgac Protospacer
***********..********** .
467. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
atccggcggcaccggcggcatgggcaa Protospacer
********* ************..
468. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
469. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
470. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
471. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
472. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
473. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
474. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
475. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggtggcggcgcaggcggcatgggcgg Protospacer
.. .******. ***************
476. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
477. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
478. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
479. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggtggcatcggcga Protospacer
. ************.***** ****.
480. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
481. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
482. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcatggcgtc Protospacer
*.**********.**********
483. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgccggcggcaaaggcggcatctgtgt Protospacer
..******************* *.*
484. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
485. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
486. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcatggcgtc Protospacer
*.**********.**********
487. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggcggcggcgacggcggcatgggcgt Protospacer
.. *******.* *************
488. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
489. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
490. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
491. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
492. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gacaggcggcaagggcggcatgggtca Protospacer
** ********.***********. .
493. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP021816 (Sinorhizobium meliloti strain M270 plasmid accessoryB, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg- CRISPR spacer
caccggcggcaaaggcggc-cgtctgac Protospacer
******************* .* .*.
494. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
495. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
496. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
497. spacer 1.3|333781|30|NZ_CP025605|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
498. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
499. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
500. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
501. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
502. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
503. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
504. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
505. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
506. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
507. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
508. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
509. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
510. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
511. spacer 3.4|366670|27|NZ_CP025605|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
512. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
513. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
514. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
515. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
516. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
517. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
518. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
519. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
520. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
521. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
522. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
523. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
524. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
525. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
526. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
527. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
528. spacer 5.6|926862|36|NZ_CP025605|CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 7, identity: 0.806
cggggccggcgtcagcggcggggctggcggggccgg CRISPR spacer
cggggccggcgtcggcggcggagctggagcgcgccg Protospacer
*************.*******.***** * * * *
529. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
530. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
531. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
532. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
533. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
534. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
535. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
536. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
537. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
538. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
539. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
540. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
541. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
542. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
543. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
544. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
545. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
546. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
547. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
548. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
549. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
550. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
551. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
552. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
553. spacer 5.13|927168|30|NZ_CP025605|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
554. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
555. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
556. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
557. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
558. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
559. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
560. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
561. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
562. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
563. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
564. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
565. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
566. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
567. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
568. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
569. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
570. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
571. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
572. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
573. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
574. spacer 5.13|927168|30|NZ_CP025605|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
575. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
576. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
577. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
578. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
579. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
580. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
581. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
582. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
583. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
584. spacer 5.13|927168|30|NZ_CP025605|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
585. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
586. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
587. spacer 5.13|927168|30|NZ_CP025605|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
588. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
589. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
590. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
591. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
592. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
593. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
594. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
595. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
596. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
597. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
598. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
599. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
600. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
601. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
602. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
603. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
604. spacer 5.13|927168|30|NZ_CP025605|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
605. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
606. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
607. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
608. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
609. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
610. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
611. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
612. spacer 5.13|927168|30|NZ_CP025605|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
613. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
614. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
615. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
616. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
617. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
618. spacer 5.13|927168|30|NZ_CP025605|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
619. spacer 5.13|927168|30|NZ_CP025605|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
620. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
621. spacer 5.13|927168|30|NZ_CP025605|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
622. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
623. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
624. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
625. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
626. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
627. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
628. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
629. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
630. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
631. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
632. spacer 5.15|927264|30|NZ_CP025605|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
633. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
634. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
635. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
636. spacer 5.15|927264|30|NZ_CP025605|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
637. spacer 5.15|927264|30|NZ_CP025605|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
638. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
639. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
640. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
641. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
642. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
643. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
644. spacer 5.17|927354|36|NZ_CP025605|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
645. spacer 8.3|2088319|30|NZ_CP025605|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
646. spacer 8.3|2088319|30|NZ_CP025605|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
647. spacer 8.3|2088319|30|NZ_CP025605|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
648. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
649. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
650. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
651. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
652. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
653. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
654. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
655. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
656. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
657. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
658. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
659. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
660. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
661. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
662. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
663. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
664. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
665. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
666. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
667. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
668. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
669. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
670. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
671. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
672. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
673. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
674. spacer 13.18|3949726|27|NZ_CP025605|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.741
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcttctcggcaaaggcggcatgggcga Protospacer
.. ********************.
675. spacer 1.3|333781|30|NZ_CP025605|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
676. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
677. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
678. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
679. spacer 1.12|334261|30|NZ_CP025605|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
680. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
681. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
682. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
683. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
684. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
685. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
686. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
687. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
688. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
689. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
690. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
691. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
692. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
693. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
694. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
695. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
696. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
697. spacer 5.13|927168|30|NZ_CP025605|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
698. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
699. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
700. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
701. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
702. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
703. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
704. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
705. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
706. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
707. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
708. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
709. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
710. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
711. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
712. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
713. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
714. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
715. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
716. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
717. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
718. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
719. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
720. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
721. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
722. spacer 5.17|927354|36|NZ_CP025605|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
723. spacer 5.17|927354|36|NZ_CP025605|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
724. spacer 5.17|927354|36|NZ_CP025605|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
725. spacer 8.3|2088319|30|NZ_CP025605|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
726. spacer 8.3|2088319|30|NZ_CP025605|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
727. spacer 11.24|3122362|29|NZ_CP025605|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
728. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
729. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
730. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
731. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
732. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
733. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
734. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
735. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
736. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
737. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
738. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
739. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
740. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
741. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
742. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
743. spacer 12.7|3741115|31|NZ_CP025605|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
744. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
745. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
746. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
747. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
748. spacer 13.8|3948835|36|NZ_CP025605|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778
tagcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
749. spacer 1.13|334309|39|NZ_CP025605|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
750. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
751. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
752. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
753. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
754. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
755. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
756. spacer 4.1|692000|31|NZ_CP025605|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
757. spacer 5.13|927168|30|NZ_CP025605|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
758. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
759. spacer 5.15|927264|30|NZ_CP025605|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
760. spacer 5.17|927354|36|NZ_CP025605|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
761. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
762. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
763. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
764. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
765. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
766. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
767. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
768. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
769. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
770. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
771. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
772. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
773. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
774. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
775. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
776. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
777. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
778. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
779. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
780. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
781. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
782. spacer 13.11|3949063|36|NZ_CP025605|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
783. spacer 13.11|3949063|36|NZ_CP025605|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
784. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
785. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
786. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
787. spacer 3.6|366805|33|NZ_CP025605|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
788. spacer 5.2|926664|39|NZ_CP025605|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
789. spacer 5.17|927354|36|NZ_CP025605|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
790. spacer 5.17|927354|36|NZ_CP025605|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
791. spacer 10.9|3119759|35|NZ_CP025605|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
792. spacer 11.20|3123234|34|NZ_CP025605|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
793. spacer 11.36|3123238|34|NZ_CP025605|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
794. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
795. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
796. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
797. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
798. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
799. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
800. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
801. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
802. spacer 12.5|3740974|34|NZ_CP025605|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
803. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
804. spacer 13.3|3948454|36|NZ_CP025605|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
805. spacer 13.5|3948598|33|NZ_CP025605|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
806. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
807. spacer 13.17|3949654|36|NZ_CP025605|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..