Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 0 crisprs csa3,RT 0 0 2 0
NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 0 crisprs RT 0 0 2 0
NZ_CP026182 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP026183 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-dfda, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 0 crisprs NA 0 0 3 0
NZ_CP026185 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP026178 Klebsiella pneumoniae strain KPNIH49 chromosome, complete genome 4 crisprs cas3,csa3,RT,DEDDh,DinG,WYL 1 0 385 0
NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 2 crisprs TnsE_C,DinG,RT,DEDDh 0 7 5 0

Results visualization

1. NZ_CP026179
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5741 : 39930 33 uncultured_Caudovirales_phage(37.5%) transposase NA
DBSCAN-SWA_2 57662 : 120656 52 Escherichia_phage(25.0%) transposase,integrase,protease attL 57165:57179|attR 104876:104890
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP026180
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 90065 72 Enterobacteria_phage(16.67%) integrase,transposase attL 10451:10465|attR 34998:35012
DBSCAN-SWA_2 93103 : 94286 3 Pectobacterium_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP026182
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6287 : 15916 9 Escherichia_phage(42.86%) integrase attL 1163:1176|attR 11923:11936
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP026181
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11791 15 Morganella_phage(14.29%) transposase NA
DBSCAN-SWA_2 16422 : 18365 4 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_3 43179 : 93288 47 Salmonella_phage(18.75%) transposase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP026178
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026178_1 4507163-4507289 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026178_2 4841492-4841631 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026178_3 5302394-5302662 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026178_4 5319372-5319478 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP026178_3 3.2|5302565|60|NZ_CP026178|PILER-CR 5302565-5302624 60 NZ_CP026178.1 5302667-5302726 2 0.967

1. spacer 3.2|5302565|60|NZ_CP026178|PILER-CR matches to position: 5302667-5302726, mismatch: 2, identity: 0.967

tgggggacgctggcattgtaggccgggcaagcgccgcgccgcccggcaaggtgttcaggc	CRISPR spacer
tgggggacgctggcattgtaggccgggcaagcgcagcgccgcccggcaaggtgtgcaggc	Protospacer
********************************** ******************* *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14860 12 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 20669 : 21461 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_3 46012 : 49523 4 Vibriophage(33.33%) NA NA
DBSCAN-SWA_4 53884 : 60407 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_5 65253 : 65988 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_6 69098 : 76953 4 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_7 86373 : 91457 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_8 95260 : 95983 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_9 103854 : 104760 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_10 115164 : 116904 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_11 120818 : 131261 10 Escherichia_phage(16.67%) transposase NA
DBSCAN-SWA_12 135335 : 140486 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_13 144488 : 145865 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_14 148874 : 150467 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_15 158447 : 160880 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_16 165123 : 166983 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_17 178846 : 180846 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_18 188318 : 199906 13 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_19 203050 : 207401 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_20 220217 : 244054 16 uncultured_Mediterranean_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_21 247131 : 250346 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_22 254397 : 255486 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 259659 : 264202 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_24 283235 : 284636 1 Bandra_megavirus(100.0%) tRNA NA
DBSCAN-SWA_25 290698 : 295821 3 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_26 304587 : 306495 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_27 319189 : 321244 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_28 333230 : 335378 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_29 344722 : 345382 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_30 369665 : 373184 4 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_31 389748 : 390807 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_32 398800 : 399328 1 Infectious_spleen_and_kidney_necrosis_virus(100.0%) NA NA
DBSCAN-SWA_33 407679 : 408600 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_34 411841 : 412093 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_35 431256 : 432438 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_36 435717 : 436359 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_37 456083 : 459834 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_38 467094 : 471937 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_39 476370 : 477507 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_40 484072 : 485443 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_41 488671 : 489922 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_42 504514 : 506299 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_43 509588 : 513172 7 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_44 520101 : 536729 15 Klebsiella_phage(11.11%) transposase NA
DBSCAN-SWA_45 540413 : 542479 2 Artogeia_rapae_granulovirus(50.0%) NA NA
DBSCAN-SWA_46 548860 : 550807 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 556109 : 556742 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_48 562799 : 564020 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_49 570703 : 571531 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_50 577795 : 583529 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_51 590823 : 591501 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_52 598799 : 601757 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_53 613222 : 618588 5 Chrysochromulina_ericina_virus(50.0%) protease NA
DBSCAN-SWA_54 623427 : 624030 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 629619 : 631554 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_56 636184 : 651714 15 Enterobacteria_phage(50.0%) transposase,integrase attL 632048:632062|attR 648748:648762
DBSCAN-SWA_57 656138 : 665522 8 Enterobacteria_phage(28.57%) transposase NA
DBSCAN-SWA_58 695539 : 700979 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_59 708965 : 714132 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_60 719136 : 720117 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_61 743467 : 744481 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_62 747802 : 754918 7 Escherichia_phage(40.0%) tRNA NA
DBSCAN-SWA_63 760036 : 761026 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_64 787219 : 791844 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_65 800529 : 801735 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_66 814484 : 818012 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_67 823114 : 823729 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_68 827165 : 828935 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_69 838799 : 842114 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_70 853380 : 853896 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_71 873242 : 876020 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_72 885463 : 886423 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_73 903547 : 905674 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_74 910470 : 920420 10 uncultured_virus(20.0%) NA NA
DBSCAN-SWA_75 929564 : 946786 15 Escherichia_phage(70.0%) transposase NA
DBSCAN-SWA_76 950937 : 952443 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_77 955689 : 956064 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_78 961141 : 962092 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_79 966615 : 967377 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_80 972825 : 974193 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_81 986579 : 987371 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_82 997864 : 999244 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_83 1033198 : 1034731 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_84 1043157 : 1045195 2 Erysipelothrix_phage(50.0%) transposase NA
DBSCAN-SWA_85 1058521 : 1059259 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_86 1083016 : 1084273 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_87 1090267 : 1094385 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_88 1098299 : 1100380 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_89 1115777 : 1116458 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_90 1127371 : 1127776 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_91 1132583 : 1134921 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_92 1140774 : 1145510 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_93 1149098 : 1150715 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_94 1161986 : 1162760 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_95 1169239 : 1170739 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_96 1176846 : 1178391 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_97 1184026 : 1184728 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_98 1194166 : 1194946 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_99 1200884 : 1201436 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_100 1206015 : 1208106 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_101 1224230 : 1225244 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_102 1232114 : 1234076 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_103 1244506 : 1247147 2 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_104 1253972 : 1256023 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_105 1261573 : 1262944 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_106 1274199 : 1275474 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_107 1278809 : 1280171 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_108 1283977 : 1285465 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_109 1289652 : 1290525 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_110 1293796 : 1305968 12 Enterobacteria_phage(16.67%) transposase NA
DBSCAN-SWA_111 1311384 : 1312155 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_112 1317339 : 1319288 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_113 1332992 : 1337510 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_114 1364748 : 1365372 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_115 1371388 : 1372459 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_116 1391991 : 1392813 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_117 1395974 : 1396748 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_118 1407398 : 1409362 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_119 1416799 : 1417549 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_120 1427469 : 1430682 3 environmental_halophage(50.0%) NA NA
DBSCAN-SWA_121 1445173 : 1445935 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_122 1455914 : 1463883 7 Hokovirus(25.0%) NA NA
DBSCAN-SWA_123 1470950 : 1478119 8 Geobacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_124 1487776 : 1490674 3 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_125 1498933 : 1505200 7 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_126 1509201 : 1510737 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_127 1527230 : 1528019 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_128 1533529 : 1570738 32 uncultured_Caudovirales_phage(33.33%) plate,tRNA,transposase NA
DBSCAN-SWA_129 1576464 : 1577163 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_130 1582379 : 1631794 71 Salmonella_phage(28.07%) integrase,holin attL 1571964:1571980|attR 1644031:1644047
DBSCAN-SWA_131 1635656 : 1637951 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_132 1654059 : 1654671 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_133 1670296 : 1677665 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_134 1681573 : 1683133 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_135 1690573 : 1693366 4 Morganella_phage(50.0%) transposase NA
DBSCAN-SWA_136 1697681 : 1699730 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_137 1707237 : 1707891 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_138 1711614 : 1712583 2 Pectobacterium_phage(50.0%) NA NA
DBSCAN-SWA_139 1720008 : 1721484 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_140 1725409 : 1741956 18 Tupanvirus(37.5%) tRNA NA
DBSCAN-SWA_141 1761993 : 1797781 48 uncultured_Caudovirales_phage(32.35%) lysis,tail,terminase,integrase attL 1761679:1761738|attR 1797908:1797969
DBSCAN-SWA_142 1803238 : 1803991 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_143 1814367 : 1819035 5 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_144 1836269 : 1837538 1 Stenotrophomonas_phage(100.0%) integrase attL 1826568:1826581|attR 1841103:1841116
DBSCAN-SWA_145 1845479 : 1850222 5 Leptospira_phage(50.0%) transposase NA
DBSCAN-SWA_146 1865743 : 1870838 3 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_147 1875344 : 1876244 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_148 1882491 : 1900398 14 Catovirus(11.11%) transposase NA
DBSCAN-SWA_149 1911672 : 1912665 1 Sulfolobales_Mexican_rudivirus(100.0%) NA NA
DBSCAN-SWA_150 1920862 : 1928696 6 Bacillus_phage(20.0%) transposase NA
DBSCAN-SWA_151 1945816 : 1952723 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_152 1979742 : 1986798 7 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_153 1993332 : 1993887 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_154 2009910 : 2011431 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_155 2015195 : 2019102 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_156 2023502 : 2024357 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_157 2032189 : 2036501 4 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_158 2042256 : 2048343 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_159 2052579 : 2066415 14 Vibrio_phage(28.57%) integrase attL 2055919:2055935|attR 2075404:2075420
DBSCAN-SWA_160 2074234 : 2074948 1 Shewanella_sp._phage(100.0%) NA NA
DBSCAN-SWA_161 2079438 : 2080599 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_162 2084517 : 2088810 3 Acanthamoeba_polyphaga_mimivirus(50.0%) transposase NA
DBSCAN-SWA_163 2093121 : 2105252 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_164 2113097 : 2114303 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2117418 : 2118372 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_166 2146401 : 2147001 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_167 2159403 : 2160177 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_168 2164468 : 2165986 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_169 2170536 : 2268671 101 Enterobacteria_phage(14.29%) terminase,tail,capsid,portal,integrase,holin,head,tRNA,protease attL 2193269:2193297|attR 2234958:2234986
DBSCAN-SWA_170 2272279 : 2274404 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_171 2277757 : 2281334 5 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_172 2313236 : 2414715 108 Salmonella_phage(29.23%) transposase,terminase,tail,capsid,integrase,holin,tRNA,protease attL 2397324:2397352|attR 2414935:2414963
DBSCAN-SWA_173 2423814 : 2424246 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_174 2434758 : 2441079 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_175 2456326 : 2478395 19 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_176 2483295 : 2586954 106 Enterobacteria_phage(29.31%) transposase,terminase,tail,portal,integrase,holin,tRNA,protease attL 2520141:2520156|attR 2577806:2577821
DBSCAN-SWA_177 2601499 : 2602402 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_178 2607583 : 2612882 5 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_179 2627599 : 2635804 8 Vibrio_phage(20.0%) tRNA NA
DBSCAN-SWA_180 2641742 : 2642708 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_181 2669649 : 2671050 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_182 2681415 : 2682237 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_183 2693980 : 2697475 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_184 2700942 : 2707361 7 uncultured_Mediterranean_phage(40.0%) NA NA
DBSCAN-SWA_185 2710431 : 2712464 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_186 2721230 : 2726567 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_187 2730109 : 2735575 3 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_188 2742989 : 2743835 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_189 2754090 : 2755113 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_190 2761517 : 2762273 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_191 2773818 : 2776319 3 environmental_halophage(50.0%) tRNA NA
DBSCAN-SWA_192 2783430 : 2785911 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_193 2788991 : 2789252 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_194 2800994 : 2801819 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_195 2834471 : 2846151 6 Deep-sea_thermophilic_phage(25.0%) NA NA
DBSCAN-SWA_196 2851662 : 2863580 10 Geobacillus_virus(25.0%) NA NA
DBSCAN-SWA_197 2869557 : 2870568 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_198 2876281 : 2877409 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_199 2883172 : 2886643 3 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_200 2902819 : 2938475 37 Escherichia_phage(33.33%) transposase,integrase attL 2899790:2899808|attR 2943577:2943595
DBSCAN-SWA_201 2941674 : 2949576 7 Clostridium_phage(20.0%) tRNA NA
DBSCAN-SWA_202 2954220 : 2955654 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_203 2963052 : 2965926 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_204 2973868 : 2975101 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_205 2991089 : 2992244 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_206 2999121 : 3000102 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_207 3008316 : 3009399 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_208 3015068 : 3016439 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_209 3036146 : 3046049 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_210 3049360 : 3051256 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_211 3055598 : 3062479 8 Erwinia_phage(25.0%) NA NA
DBSCAN-SWA_212 3067590 : 3068832 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_213 3078125 : 3083509 4 Moraxella_phage(33.33%) tRNA NA
DBSCAN-SWA_214 3091671 : 3092475 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_215 3110553 : 3111933 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_216 3116204 : 3117692 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_217 3127255 : 3128227 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_218 3145365 : 3146511 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_219 3151785 : 3159661 10 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_220 3165354 : 3167286 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_221 3172700 : 3179319 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_222 3183583 : 3186460 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_223 3193058 : 3194500 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_224 3198549 : 3211480 15 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_225 3215424 : 3216357 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_226 3223802 : 3224297 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_227 3228242 : 3229610 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_228 3247318 : 3248362 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_229 3275898 : 3277370 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_230 3297273 : 3300642 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_231 3308487 : 3318131 9 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_232 3329532 : 3330360 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_233 3345183 : 3348955 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_234 3361781 : 3364172 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_235 3367516 : 3368275 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_236 3371336 : 3373784 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_237 3391528 : 3393336 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_238 3396761 : 3398994 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_239 3410918 : 3416719 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_240 3419803 : 3424163 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_241 3430462 : 3434569 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_242 3440671 : 3441463 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_243 3451834 : 3453877 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_244 3497616 : 3503590 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_245 3514648 : 3517388 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_246 3522547 : 3523519 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_247 3526922 : 3530427 4 Morganella_phage(33.33%) transposase NA
DBSCAN-SWA_248 3534330 : 3535326 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_249 3540795 : 3542337 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_250 3550311 : 3552153 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_251 3566804 : 3575953 9 Rhizobium_phage(20.0%) NA NA
DBSCAN-SWA_252 3580385 : 3581369 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_253 3588889 : 3593631 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_254 3599695 : 3601629 2 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_255 3605930 : 3614813 12 Morganella_phage(50.0%) integrase attL 3596637:3596652|attR 3618571:3618586
DBSCAN-SWA_256 3620150 : 3628441 7 Acanthamoeba_polyphaga_mimivirus(25.0%) NA NA
DBSCAN-SWA_257 3639422 : 3640274 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_258 3643408 : 3644800 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_259 3658059 : 3659109 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_260 3676244 : 3677408 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_261 3695661 : 3696774 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_262 3708952 : 3716301 7 Micromonas_sp._RCC1109_virus(33.33%) NA NA
DBSCAN-SWA_263 3727311 : 3729231 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_264 3732672 : 3733821 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_265 3739588 : 3747179 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_266 3754599 : 3755937 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_267 3761713 : 3769273 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_268 3785781 : 3791660 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_269 3806120 : 3808913 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_270 3812801 : 3815269 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_271 3822091 : 3823009 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_272 3845980 : 3847492 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_273 3855791 : 3863238 7 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_274 3867172 : 3868507 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_275 3885899 : 3886562 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_276 3901192 : 3903031 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_277 3913094 : 3914741 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_278 3922844 : 3924866 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_279 3929357 : 3931294 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_280 3935344 : 3941486 6 Catovirus(20.0%) NA NA
DBSCAN-SWA_281 3957768 : 3961613 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_282 3965449 : 3968911 3 Catovirus(50.0%) transposase NA
DBSCAN-SWA_283 3980912 : 3984256 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_284 3992973 : 3993588 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_285 4003451 : 4006572 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_286 4010799 : 4023243 6 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_287 4031668 : 4033432 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_288 4038853 : 4040443 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_289 4054154 : 4057838 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_290 4076552 : 4077662 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_291 4084728 : 4085337 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_292 4091331 : 4093858 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_293 4097039 : 4102346 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_294 4105895 : 4106927 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_295 4114456 : 4115806 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_296 4119723 : 4120647 1 Enterobacteria_phage(100.0%) transposase NA
DBSCAN-SWA_297 4127111 : 4129070 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_298 4134918 : 4137066 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_299 4143007 : 4144528 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_300 4149849 : 4151396 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_301 4156756 : 4158259 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_302 4162623 : 4273603 112 Vibrio_phage(52.0%) tail,integrase,plate,transposase,tRNA,protease attL 4166920:4166937|attR 4212400:4212417
DBSCAN-SWA_303 4293200 : 4294025 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_304 4308282 : 4314795 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_305 4330924 : 4334145 3 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_306 4341902 : 4347960 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_307 4352119 : 4361169 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_308 4375513 : 4380336 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_309 4383486 : 4384758 1 Enterobacteria_phage(100.0%) integrase attL 4382755:4382768|attR 4392373:4392386
DBSCAN-SWA_310 4388599 : 4390240 1 Acidithiobacillus_phage(100.0%) NA NA
DBSCAN-SWA_311 4394904 : 4397741 2 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_312 4409456 : 4409927 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_313 4414357 : 4415468 1 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_314 4441933 : 4446891 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_315 4450129 : 4452236 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_316 4461993 : 4464738 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_317 4468653 : 4470138 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_318 4485724 : 4486651 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_319 4493144 : 4494125 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_320 4519112 : 4525913 8 Escherichia_phage(33.33%) transposase NA
DBSCAN-SWA_321 4529073 : 4530353 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_322 4543576 : 4546297 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_323 4551032 : 4552355 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_324 4558686 : 4563846 3 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_325 4581002 : 4581956 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_326 4586351 : 4596305 7 Chrysochromulina_ericina_virus(25.0%) tRNA NA
DBSCAN-SWA_327 4602871 : 4604020 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_328 4610503 : 4612422 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_329 4624880 : 4630332 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_330 4636628 : 4637330 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_331 4646029 : 4646785 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_332 4656462 : 4659715 3 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_333 4685908 : 4686952 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_334 4691219 : 4691783 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_335 4703123 : 4704548 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_336 4716122 : 4722781 5 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_337 4728183 : 4734954 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_338 4759911 : 4760709 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_339 4766675 : 4767020 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_340 4770975 : 4772409 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_341 4783986 : 4784745 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_342 4793576 : 4797676 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_343 4810659 : 4811691 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_344 4818270 : 4819074 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_345 4823139 : 4827349 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_346 4832857 : 4833439 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_347 4850612 : 4851896 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_348 4859429 : 4860425 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_349 4865075 : 4866473 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_350 4879681 : 4885466 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_351 4891743 : 4892586 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_352 4901660 : 4905382 5 Planktothrix_phage(66.67%) NA NA
DBSCAN-SWA_353 4916368 : 4917136 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_354 4938227 : 4946747 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_355 4959589 : 4960570 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_356 4964180 : 4968519 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_357 4972118 : 4976778 6 Indivirus(33.33%) NA NA
DBSCAN-SWA_358 4989581 : 4991261 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_359 5005567 : 5010736 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_360 5013966 : 5014668 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_361 5019095 : 5022639 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_362 5028708 : 5034363 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_363 5044307 : 5045417 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_364 5054591 : 5063982 10 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_365 5071791 : 5077320 5 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_366 5087440 : 5158980 91 Cronobacter_phage(19.67%) transposase,terminase,tail,head,integrase,holin,tRNA,protease attL 5103365:5103424|attR 5157368:5158416
DBSCAN-SWA_367 5164163 : 5165084 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_368 5171307 : 5174632 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_369 5183152 : 5188954 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_370 5195579 : 5196377 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_371 5215122 : 5216987 3 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_372 5243839 : 5246554 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_373 5255507 : 5264180 9 Planktothrix_phage(75.0%) NA NA
DBSCAN-SWA_374 5268737 : 5274651 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_375 5281354 : 5282899 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_376 5294293 : 5299034 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_377 5311491 : 5315912 5 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_378 5332988 : 5346703 12 Cedratvirus(20.0%) NA NA
DBSCAN-SWA_379 5349838 : 5351909 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_380 5355999 : 5356660 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_381 5361538 : 5364025 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_382 5371069 : 5377050 4 Staphylococcus_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_383 5383054 : 5384101 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_384 5388141 : 5389806 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_385 5394559 : 5398361 2 Vibrio_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP026186
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026186_1 38316-38610 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026186_2 221169-221441 Orphan NA
4 spacers
DinG,RT,DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38377-38432 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38494-38549 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191568-191623 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191685-191740 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213831-213886 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213948-214003 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228349-228404 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228466-228521 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279048-279103 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279165-279220 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 51823-51878 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 51940-51995 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99420-99475 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38377-38432 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38494-38549 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191568-191623 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191685-191740 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213831-213886 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213948-214003 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228349-228404 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228466-228521 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279048-279103 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279165-279220 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 51823-51878 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 51940-51995 0 1.0
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99420-99475 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306137-306168 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP019902 Raoultella planticola strain GODA plasmid unnamed3, complete sequence 4647-4678 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53121-53152 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32453-32484 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17641-17672 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17702-17733 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP025945 Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence 7737-7768 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251827-251858 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 115043-115074 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201064-201095 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7634-7665 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7694-7725 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223968-223999 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25434-25465 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33519-33550 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30341-30372 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30600-30631 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32453-32484 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221198-221229 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28069-28100 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 139046-139077 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7758-7789 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300579-300610 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP029779 Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence 3002-3033 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136334-136365 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30091-30122 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62331-62362 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332609-332640 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229687-229718 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28336-28367 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313822-313853 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 10971-11002 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3767-3798 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142564-142595 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37329-37360 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243834-243865 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114771-114802 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144825-144856 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168178-168209 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP038459 Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence 2472-2503 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254623-254654 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30091-30122 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32453-32484 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53655-53686 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132575-132606 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132210-132241 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29357-29388 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42784-42815 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100575-100606 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57061-57092 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85368-85399 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30155-30186 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32479-32510 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130323-130354 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28312-28343 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130407-130438 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42999-43030 0 1.0
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59840-59871 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306076-306107 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149464-149495 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32514-32545 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8627-8658 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24648-24679 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5091-5122 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17580-17611 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30159-30190 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP036322 Klebsiella pneumoniae strain VBA2172 plasmid pCol440I 5889-5920 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7755-7786 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223907-223938 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25495-25526 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33580-33611 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30402-30433 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32514-32545 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227556-227587 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221259-221290 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138985-139016 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7819-7850 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP033949 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence 5194-5225 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8221-8252 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30152-30183 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP034676 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence 621-652 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28458-28489 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277808-277839 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30155-30186 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11093-11124 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP011627 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-14, complete sequence 6312-6343 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142503-142534 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95713-95744 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128184-128215 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243773-243804 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117606-117637 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30097-30128 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168239-168270 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75928-75959 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60590-60621 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30152-30183 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32514-32545 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102228-102259 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54746-54777 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48709-48740 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279373-279404 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP044044 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence 6623-6654 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100514-100545 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57183-57214 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85307-85338 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30094-30125 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130384-130415 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28434-28465 0 1.0
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130468-130499 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149403-149434 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53243-53274 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8566-8597 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24709-24740 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5152-5183 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17519-17550 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30220-30251 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 251888-251919 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114982-115013 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 201003-201034 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7815-7846 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223846-223877 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227617-227648 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221320-221351 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28191-28222 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138924-138955 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7880-7911 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300457-300488 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8160-8191 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136395-136426 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62392-62423 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332731-332762 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229748-229779 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28519-28550 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313761-313792 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277747-277778 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30216-30247 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11154-11185 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 3828-3859 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42138-42169 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95652-95683 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128123-128154 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37390-37421 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243712-243743 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114710-114741 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117545-117576 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144947-144978 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30158-30189 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60651-60682 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254562-254593 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53716-53747 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102289-102320 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54807-54838 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132697-132728 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48770-48801 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279312-279343 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29479-29510 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 42845-42876 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57244-57275 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85246-85277 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30033-30064 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130445-130476 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130529-130560 0 1.0
NZ_CP026186_2 2.3|221320|32|NZ_CP026186|CRT 221320-221351 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59779-59810 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 305900-305931 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149166-149197 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53487-53518 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32690-32721 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8329-8360 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24946-24977 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5389-5420 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30457-30488 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252131-252162 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114738-114769 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 200759-200790 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223785-223816 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25671-25702 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33756-33787 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31650-31681 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30578-30609 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32690-32721 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227861-227892 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221381-221412 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28435-28466 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 138687-138718 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 8114-8145 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300213-300244 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7916-7947 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136639-136670 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30328-30359 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62636-62667 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332975-333006 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 229992-230023 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28763-28794 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313517-313548 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277564-277595 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30453-30484 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11398-11429 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4071-4102 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42382-42413 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95415-95446 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 127886-127917 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 37686-37717 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243414-243445 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114466-114497 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117308-117339 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145191-145222 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30395-30426 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168415-168446 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75684-75715 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60888-60919 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 254265-254296 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30328-30359 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32690-32721 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 53960-53991 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102526-102557 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 55044-55075 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132941-132972 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 49007-49038 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132454-132485 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29723-29754 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 43143-43174 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100338-100369 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57488-57519 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85009-85040 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 29796-29827 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 32655-32686 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130682-130713 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28678-28709 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130766-130797 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42755-42786 0 1.0
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59535-59566 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 32497-32530 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 24631-24664 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 5074-5107 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 30142-30175 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 7738-7771 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 25478-25511 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 33563-33596 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 30385-30418 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 32497-32530 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227539-227572 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 221242-221275 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP031580 Klebsiella pneumoniae strain N4b plasmid p1502320-3 7802-7835 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 30135-30168 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28441-28474 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 30138-30171 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11076-11109 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 30080-30113 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 168222-168255 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 60573-60606 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 30135-30168 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 32497-32530 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 102211-102244 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 54729-54762 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 48692-48725 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57166-57199 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 130367-130400 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28417-28450 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 130451-130484 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 306091-306124 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 149479-149512 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 8642-8675 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 17595-17628 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223922-223955 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 139000-139033 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8236-8269 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 277823-277856 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 142518-142551 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 95728-95761 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 128199-128232 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 243788-243821 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 117621-117654 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75943-75976 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279388-279421 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 100529-100562 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 85322-85355 0 1.0
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 30109-30142 0 1.0
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172807-172862 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 85991-86046 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 197907-197962 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 198024-198079 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192567-192622 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192684-192739 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128157-128212 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128274-128329 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128625-128680 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128742-128797 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 129093-129148 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 129210-129265 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127092-127147 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127443-127498 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127794-127849 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 128145-128200 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115561-115616 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115678-115733 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69323-69378 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115561-115616 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115678-115733 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115561-115616 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115678-115733 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127091-127146 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127208-127263 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127559-127614 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127676-127731 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 128027-128082 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 128144-128199 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 106905-106960 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190541-190596 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190658-190713 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 125899-125954 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126250-126305 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126601-126656 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126952-127007 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 26591-26646 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94340-94395 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94457-94512 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94808-94863 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94925-94980 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 95276-95331 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 95393-95448 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266448-266503 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266565-266620 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2637-2692 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2754-2809 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 86544-86599 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91451-91506 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91568-91623 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91919-91974 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92036-92091 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92387-92442 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92504-92559 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49078-49133 1 0.982
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47751-47806 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172807-172862 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 85991-86046 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 197907-197962 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 MN543575 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence 198024-198079 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192567-192622 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 MN543576 Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence 192684-192739 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128157-128212 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128274-128329 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128625-128680 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 128742-128797 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 129093-129148 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052269 Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence 129210-129265 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127092-127147 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127443-127498 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 127794-127849 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052208 Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence 128145-128200 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115561-115616 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024517 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence 115678-115733 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 69323-69378 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115561-115616 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024497 Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence 115678-115733 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115561-115616 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024501 Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence 115678-115733 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127091-127146 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127208-127263 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127559-127614 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 127676-127731 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 128027-128082 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052242 Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence 128144-128199 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP023978 Klebsiella variicola strain X39 plasmid pX39-1, complete sequence 106905-106960 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190541-190596 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP032356 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence 190658-190713 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 125899-125954 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126250-126305 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126601-126656 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052488 Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence 126952-127007 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 26591-26646 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94340-94395 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94457-94512 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94808-94863 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 94925-94980 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 95276-95331 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052310 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence 95393-95448 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266448-266503 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP048109 Klebsiella michiganensis strain BD177 plasmid unnamed1 266565-266620 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2637-2692 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 2754-2809 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052558 Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence 86544-86599 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91451-91506 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91568-91623 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 91919-91974 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92036-92091 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92387-92442 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP052233 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence 92504-92559 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 49078-49133 1 0.982
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 47751-47806 1 0.982
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 227495-227526 1 0.969
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 8282-8313 1 0.969
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_CP050828 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence 8408-8439 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28397-28428 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279434-279465 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57122-57153 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28373-28404 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325885-325916 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158963-158994 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31467-31498 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30661-30692 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28130-28161 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11022-11053 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP024491 Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence 2511-2542 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115786-115817 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240104-240135 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP050824 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence 203-234 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP034050 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed5, complete sequence 2460-2491 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 CP052340 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-3, complete sequence 686-717 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132636-132667 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132271-132302 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29418-29449 1 0.969
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42938-42969 1 0.969
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28380-28413 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11015-11048 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57105-57138 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28356-28389 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279449-279482 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 325868-325901 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 158946-158979 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31450-31483 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30644-30677 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 28113-28146 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115769-115802 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 132619-132652 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 132254-132287 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 29401-29434 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 11037-11070 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 240119-240152 1 0.971
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 42953-42986 1 0.971
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99654-99709 2 0.964
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172924-172979 2 0.964
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 185091-185146 2 0.964
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 99654-99709 2 0.964
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_MK773537 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence 172924-172979 2 0.964
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NC_011282 Klebsiella variicola strain 342 plasmid pKP187, complete sequence 185091-185146 2 0.964
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11032-11063 2 0.938
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53182-53213 2 0.938
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300518-300549 2 0.938
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332670-332701 2 0.938
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42077-42108 2 0.938
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144886-144917 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 109028-109059 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 2873-2904 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 21051-21082 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 35469-35500 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP011587 Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence 43562-43593 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 17901-17932 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 67978-68009 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 138432-138463 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018361 Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence 128487-128518 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 22387-22418 2 0.938
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 83959-83990 2 0.938
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53165-53198 2 0.941
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 332653-332686 2 0.941
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42060-42093 2 0.941
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 144869-144902 2 0.941
NZ_CP026186_2 2.5|221242|34|NZ_CP026186|CRISPRCasFinder 221242-221275 34 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 300533-300566 2 0.941
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38260-38315 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191451-191506 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213714-213769 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228232-228287 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279282-279337 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 52057-52112 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182166-182221 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217735-217790 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139983-140038 3 0.946
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 122263-122318 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 38260-38315 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP045194 Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence 191451-191506 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 213714-213769 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP028952 Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence 228232-228287 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 CP027603 UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence 279282-279337 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP021697 Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence 52057-52112 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 182166-182221 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 217735-217790 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 139983-140038 3 0.946
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP050823 Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence 122263-122318 3 0.946
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 43520-43551 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_KR822246 Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence 5208-5239 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_KJ958926 Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence 4882-4913 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_LN824135 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671 32898-32929 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP015502 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence 24918-24949 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 10160-10191 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP025214 Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence 79984-80015 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP012569 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence 27705-27736 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP024835 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence 20164-20195 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP021687 Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence 74196-74227 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 195576-195607 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 27095-27126 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP024839 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence 68250-68281 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 43913-43944 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP012564 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence 32775-32806 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP024431 Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence 30482-30513 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 MN792917 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence 37625-37656 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 9942-9973 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP050361 Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence 37962-37993 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NC_021198 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence 4858-4889 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP032188 Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence 45171-45202 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP020050 Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence 103264-103295 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 NZ_CP021758 Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence 66379-66410 3 0.906
NZ_CP026186_2 2.4|221381|32|NZ_CP026186|CRT 221381-221412 32 MN688131 Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence 30882-30913 3 0.906
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289834-289889 5 0.911
NZ_CP026186_1 1.1|38377|56|NZ_CP026186|PILER-CR 38377-38432 56 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290301-290356 5 0.911
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 289834-289889 5 0.911
NZ_CP026186_1 1.2|38494|56|NZ_CP026186|PILER-CR 38494-38549 56 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 290301-290356 5 0.911
NZ_CP026186_2 2.1|221198|32|NZ_CP026186|CRT 221198-221229 32 NZ_FO704549 Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence 2602-2633 5 0.844
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 MG641885 Salmonella phage PMBT28, complete genome 7834-7865 8 0.75
NZ_CP026186_2 2.2|221259|32|NZ_CP026186|CRT 221259-221290 32 KC292028 Halovirus HCTV-2, complete genome 49760-49791 9 0.719

1. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

2. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

3. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

4. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

5. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

6. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

7. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

8. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

9. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

10. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

11. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

12. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

13. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

14. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

15. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

16. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

17. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

18. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

19. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

20. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

21. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

22. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

23. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

24. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

25. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

26. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 0, identity: 1.0

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
********************************************************

27. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

28. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP019902 (Raoultella planticola strain GODA plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

29. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

30. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

31. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

32. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

33. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP025945 (Escherichia coli strain SCEC020023 plasmid p1_020023, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

34. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

35. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

36. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

37. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

38. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

39. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

40. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

41. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

42. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

43. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

44. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

45. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

46. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

47. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

48. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

49. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

50. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP029779 (Klebsiella pneumoniae strain WCHKP020034 plasmid p1_020034, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

51. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

52. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

53. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

54. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

55. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

56. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

57. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

58. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

59. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

60. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

61. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

62. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

63. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

64. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

65. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

66. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP038459 (Escherichia coli strain EC-129 plasmid pEC129_6, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

67. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

68. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

69. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

70. spacer 2.1|221198|32|NZ_CP026186|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

71. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

72. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

73. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

74. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

75. spacer 2.1|221198|32|NZ_CP026186|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

76. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

77. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

78. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

79. spacer 2.1|221198|32|NZ_CP026186|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

80. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

81. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

82. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

83. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

84. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgtcacccgctggctggaa	Protospacer
********************************

85. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

86. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

87. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

88. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

89. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

90. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

91. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

92. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

93. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP036322 (Klebsiella pneumoniae strain VBA2172 plasmid pCol440I) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

94. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

95. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

96. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

97. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

98. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

99. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

100. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

101. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

102. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

103. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

104. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP033949 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

105. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

106. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

107. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP034676 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_6kb, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

108. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

109. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

110. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

111. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

112. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP011627 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-14, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

113. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

114. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

115. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

116. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

117. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

118. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

119. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

120. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

121. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

122. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

123. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

124. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

125. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

126. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

127. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

128. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP044044 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

129. spacer 2.2|221259|32|NZ_CP026186|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

130. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

131. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

132. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

133. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

134. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

135. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtgttgtccacggttacccgctggctggaa	Protospacer
********************************

136. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

137. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

138. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

139. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

140. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

141. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

142. spacer 2.3|221320|32|NZ_CP026186|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

143. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

144. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

145. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

146. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

147. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

148. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

149. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

150. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

151. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

152. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

153. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

154. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

155. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

156. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

157. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

158. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

159. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

160. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

161. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

162. spacer 2.3|221320|32|NZ_CP026186|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

163. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

164. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

165. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

166. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

167. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

168. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

169. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

170. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

171. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

172. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

173. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

174. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

175. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

176. spacer 2.3|221320|32|NZ_CP026186|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

177. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

178. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

179. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

180. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

181. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

182. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

183. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

184. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

185. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

186. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

187. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

188. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

189. spacer 2.3|221320|32|NZ_CP026186|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

aggtatttgacctcatccagaaaggcacagac	CRISPR spacer
aggtatttgacctcatccagaaaggcacagac	Protospacer
********************************

190. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

191. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

192. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

193. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

194. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

195. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

196. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

197. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

198. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

199. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

200. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

201. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

202. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

203. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

204. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

205. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

206. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

207. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

208. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

209. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

210. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

211. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

212. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

213. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

214. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

215. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

216. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

217. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

218. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

219. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

220. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

221. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

222. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

223. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

224. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

225. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

226. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

227. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

228. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

229. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

230. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

231. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

232. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

233. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

234. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

235. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

236. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

237. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

238. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

239. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

240. spacer 2.4|221381|32|NZ_CP026186|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

241. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

242. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

243. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

244. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

245. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

246. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

247. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

248. spacer 2.4|221381|32|NZ_CP026186|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

249. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

250. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

251. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

252. spacer 2.4|221381|32|NZ_CP026186|CRT matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

253. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

254. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

255. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

256. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

257. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggcaaccttcataaaaacgtctttt	Protospacer
********************************

258. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

259. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

260. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

261. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

262. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

263. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

264. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

265. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

266. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

267. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

268. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

269. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP031580 (Klebsiella pneumoniae strain N4b plasmid p1502320-3) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

270. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

271. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

272. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

273. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

274. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

275. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

276. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

277. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

278. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

279. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

280. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

281. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

282. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

283. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

284. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

285. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

286. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

287. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

288. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

289. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

290. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

291. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

292. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

293. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

294. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

295. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

296. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

297. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

298. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

299. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

300. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

301. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

302. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

303. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtcgtgttgtccacggtt	Protospacer
**********************************

304. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
 *******************************************************

305. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

306. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

307. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

308. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

309. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

310. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

311. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

312. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

313. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

314. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

315. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

316. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

317. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

318. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

319. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

320. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

321. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

322. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatgcccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
*********** ********************************************

323. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

324. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

325. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

326. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

327. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

328. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

329. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

330. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

331. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

332. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

333. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

334. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

335. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

336. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

337. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

338. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

339. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

340. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

341. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

342. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

343. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

344. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

345. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

346. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

347. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

348. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

349. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

350. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

351. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

352. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

353. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

354. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

355. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

356. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

357. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

358. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatgcccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
*********** ********************************************

359. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatgcccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
*********** ********************************************

360. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
 *******************************************************

361. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

362. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

363. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to MN543575 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

364. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

365. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to MN543576 (Klebsiella pneumoniae strain GH44TC plasmid pGH44TC_vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

366. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

367. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

368. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

369. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

370. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

371. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052269 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

372. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

373. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

374. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

375. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052208 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

376. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

377. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024517 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

378. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatgcccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
*********** ********************************************

379. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

380. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024497 (Klebsiella pneumoniae strain KSB1_7E plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

381. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

382. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024501 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

383. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

384. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

385. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

386. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

387. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

388. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052242 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

389. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP023978 (Klebsiella variicola strain X39 plasmid pX39-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

390. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

391. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP032356 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_Vir, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

392. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

393. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

394. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

395. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052488 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

396. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

397. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

398. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

399. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

400. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

401. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

402. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052310 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

403. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

404. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP048109 (Klebsiella michiganensis strain BD177 plasmid unnamed1) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

405. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

406. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

407. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052558 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

408. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

409. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

410. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

411. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

412. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

413. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP052233 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-2, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
*****************************************************.**

414. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatgcccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
*********** ********************************************

415. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 1, identity: 0.982

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatgcccggccatttaacggtgcgtcgaatacagtagaccattgcttc	Protospacer
*********** ********************************************

416. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaa	Protospacer
****************.***************

417. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tggtgctctcaaccgttacccgctggctggaa	Protospacer
****************.***************

418. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_CP050828 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-2, complete sequence) position: , mismatch: 1, identity: 0.969

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tcgtgctctcaaccgtcacccgctggctggaa	Protospacer
* ******************************

419. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

420. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

421. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

422. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

423. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

424. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

425. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

426. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

427. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

428. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

429. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP024491 (Klebsiella pneumoniae strain INF249 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

430. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

431. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

432. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP050824 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-2, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

433. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP034050 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

434. spacer 2.2|221259|32|NZ_CP026186|CRT matches to CP052340 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-3, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

435. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

436. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

437. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

438. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.969

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgctggctggaa	Protospacer
* ******************************

439. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

440. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

441. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

442. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

443. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

444. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

445. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

446. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

447. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

448. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

449. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

450. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

451. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

452. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

453. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

454. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

455. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.971

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtt	Protospacer
****************** ***************

456. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 2, identity: 0.964

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
 ****************************************************.**

457. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.964

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
*****************************************************.* 

458. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 2, identity: 0.964

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
 ****************************************************.**

459. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 2, identity: 0.964

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
 ****************************************************.**

460. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_MK773537 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-C, complete sequence) position: , mismatch: 2, identity: 0.964

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
*****************************************************.* 

461. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NC_011282 (Klebsiella variicola strain 342 plasmid pKP187, complete sequence) position: , mismatch: 2, identity: 0.964

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctc	Protospacer
 ****************************************************.**

462. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggttacccgcaggctggaa	Protospacer
* ********************* ********

463. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
* **************.***************

464. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
* **************.***************

465. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
* **************.***************

466. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
* **************.***************

467. spacer 2.2|221259|32|NZ_CP026186|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 2, identity: 0.938

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tggtgttgtccacggtcacccgctggctggaa	Protospacer
* **************.***************

468. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

469. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

470. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

471. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

472. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP011587 (Enterobacter asburiae strain CAV1043 plasmid pCAV1043-51, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

473. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

474. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

475. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

476. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

477. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

478. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 2, identity: 0.938

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
cgaaaacggaaaccttcataaaaacgtctgtt	Protospacer
********* ******************* **

479. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 2, identity: 0.941

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
****************** **************.

480. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 2, identity: 0.941

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
****************** **************.

481. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
****************** **************.

482. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 2, identity: 0.941

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
****************** **************.

483. spacer 2.5|221242|34|NZ_CP026186|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 2, identity: 0.941

tgtgcgggggttatcggtcgtgttgtccacggtt	CRISPR spacer
tgtgcgggggttatcggtggtgttgtccacggtc	Protospacer
****************** **************.

484. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

485. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

486. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

487. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

488. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

489. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

490. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

491. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

492. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

493. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

494. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

495. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

496. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

497. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP028952 (Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

498. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

499. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
taaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcctg	Protospacer
 ****************************************************.* 

500. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

501. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

502. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

503. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 3, identity: 0.946

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccatttcctt	Protospacer
*************************************************** *.*.

504. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

505. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

506. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_KJ958926 (Klebsiella pneumoniae strain Kpn-3002cz plasmid pB-3002cz, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

507. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

508. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

509. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

510. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP025214 (Klebsiella pneumoniae strain HZW25 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

511. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP012569 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

512. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

513. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP021687 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001186, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

514. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

515. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

516. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

517. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

518. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP012564 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

519. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

520. spacer 2.4|221381|32|NZ_CP026186|CRT matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

521. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

522. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

523. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

524. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP032188 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

525. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

526. spacer 2.4|221381|32|NZ_CP026186|CRT matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

527. spacer 2.4|221381|32|NZ_CP026186|CRT matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 3, identity: 0.906

cgaaaacggcaaccttcataaaaacgtctttt	CRISPR spacer
ggaaaacggaaaccttcataaaaacgtctgtt	Protospacer
 ******** ******************* **

528. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 5, identity: 0.911

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggtcatttaacggtgcgtcgcatacagtagaccatttcctt	Protospacer
*****************.***************** *************** *.*.

529. spacer 1.1|38377|56|NZ_CP026186|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 5, identity: 0.911

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggtcatttaacggtgcgtcgcatacagtagaccatttcctt	Protospacer
*****************.***************** *************** *.*.

530. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 5, identity: 0.911

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggtcatttaacggtgcgtcgcatacagtagaccatttcctt	Protospacer
*****************.***************** *************** *.*.

531. spacer 1.2|38494|56|NZ_CP026186|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 5, identity: 0.911

gaaccggcgatccccggccatttaacggtgcgtcgaatacagtagaccattgcttc	CRISPR spacer
gaaccggcgatccccggtcatttaacggtgcgtcgcatacagtagaccatttcctt	Protospacer
*****************.***************** *************** *.*.

532. spacer 2.1|221198|32|NZ_CP026186|CRT matches to NZ_FO704549 (Xenorhabdus doucetiae strain FRM16 plasmid XD_p, complete sequence) position: , mismatch: 5, identity: 0.844

tggtgctctcaaccgtcacccgctggctggaa	CRISPR spacer
tcgttctctccaccgtcacccgctggctggcg	Protospacer
* ** ***** ******************* .

533. spacer 2.2|221259|32|NZ_CP026186|CRT matches to MG641885 (Salmonella phage PMBT28, complete genome) position: , mismatch: 8, identity: 0.75

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
tcgtcttgtccacggttccccgccgtcacggg	Protospacer
**** ************ *****.* *  *..

534. spacer 2.2|221259|32|NZ_CP026186|CRT matches to KC292028 (Halovirus HCTV-2, complete genome) position: , mismatch: 9, identity: 0.719

tcgtgttgtccacggttacccgctggctggaa	CRISPR spacer
ttcaccagtccacggtttcccgctggatggac	Protospacer
*.   . ********** ******** **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2428 : 47109 34 Dinoroseobacter_phage(25.0%) protease,integrase,transposase attL 29921:29936|attR 48470:48485
DBSCAN-SWA_2 104499 : 137774 28 Enterobacteria_phage(55.56%) transposase NA
DBSCAN-SWA_3 167613 : 174805 10 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_4 197571 : 205177 14 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_5 235084 : 294729 56 Bacillus_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage