Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026325 Helicobacter pylori strain dRdM1 chromosome, complete genome 4 crisprs cas2,cas14j,DEDDh 1 1 2 0

Results visualization

1. NZ_CP026325
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026325_1 350521-350647 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026325_2 556223-556510 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026325_3 982197-982338 Orphan I-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026325_4 1170444-1170532 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP026325_2 2.1|556286|54|NZ_CP026325|PILER-CR 556286-556339 54 NZ_CP026325.1 555956-556009 1 0.981

1. spacer 2.1|556286|54|NZ_CP026325|PILER-CR matches to position: 555956-556009, mismatch: 1, identity: 0.981

cattcctagctcttgatacgcagtccaaataagccttaatgcttttcttaactt	CRISPR spacer
cattcctagctcttgatacgcagtccaaataagccttaacgcttttcttaactt	Protospacer
***************************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026325_3 3.2|982285|23|NZ_CP026325|PILER-CR 982285-982307 23 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 183244-183266 3 0.87

1. spacer 3.2|982285|23|NZ_CP026325|PILER-CR matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 3, identity: 0.87

acgccagctttgataacgacacc	CRISPR spacer
gcgccagctttgatatcgacacg	Protospacer
.************** ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1022357 : 1074276 44 Helicobacter_phage(50.0%) tRNA,integrase,transposase attL 1032864:1032883|attR 1084199:1084218
DBSCAN-SWA_2 1430839 : 1438559 7 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage