Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026323 Helicobacter pylori strain 26695-dRdM1dM2 chromosome, complete genome 3 crisprs cas2,cas14j,DEDDh 1 0 2 0

Results visualization

1. NZ_CP026323
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026323_1 350509-350635 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026323_2 556209-556496 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026323_3 1166552-1166640 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP026323_2 2.1|556272|54|NZ_CP026323|PILER-CR 556272-556325 54 NZ_CP026323.1 555942-555995 1 0.981

1. spacer 2.1|556272|54|NZ_CP026323|PILER-CR matches to position: 555942-555995, mismatch: 1, identity: 0.981

cattcctagctcttgatacgcagtccaaataagccttaatgcttttcttaactt	CRISPR spacer
cattcctagctcttgatacgcagtccaaataagccttaacgcttttcttaactt	Protospacer
***************************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1018467 : 1070386 44 Helicobacter_phage(50.0%) tRNA,transposase,integrase attL 1028974:1028993|attR 1080308:1080327
DBSCAN-SWA_2 1426944 : 1434664 7 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage