Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026515 Helicobacter pylori strain dRdM2addM2 chromosome, complete genome 4 crisprs cas2,cas14j,DEDDh 1 0 1 0

Results visualization

1. NZ_CP026515
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026515_1 350530-350656 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026515_2 556231-556518 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026515_3 980285-980480 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026515_4 1168598-1168686 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP026515_2 2.1|556294|54|NZ_CP026515|PILER-CR 556294-556347 54 NZ_CP026515.1 555964-556017 1 0.981

1. spacer 2.1|556294|54|NZ_CP026515|PILER-CR matches to position: 555964-556017, mismatch: 1, identity: 0.981

cattcctagctcttgatacgcagtccaaataagccttaatgcttttcttaactt	CRISPR spacer
cattcctagctcttgatacgcagtccaaataagccttaacgcttttcttaactt	Protospacer
***************************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1020505 : 1072430 45 Helicobacter_phage(50.0%) integrase,transposase,tRNA attL 1031012:1031031|attR 1082353:1082372
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage