Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020008 Haemophilus influenzae strain 5P28H1 chromosome, complete genome 1 crisprs DEDDh,DinG,cas3,WYL 1 0 8 0

Results visualization

1. NZ_CP020008
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020008_1 1432806-1432900 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP020008_1 1.1|1432829|49|NZ_CP020008|CRISPRCasFinder 1432829-1432877 49 NZ_CP020008.1 1432793-1432841 1 0.98

1. spacer 1.1|1432829|49|NZ_CP020008|CRISPRCasFinder matches to position: 1432793-1432841, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 373150 : 441107 79 Haemophilus_phage(13.16%) portal,terminase,tail,holin,tRNA NA
DBSCAN-SWA_2 445123 : 453313 14 Mannheimia_phage(42.86%) integrase attL 439620:439634|attR 456307:456321
DBSCAN-SWA_3 635165 : 642887 9 Macacine_betaherpesvirus(42.86%) transposase NA
DBSCAN-SWA_4 1286449 : 1294958 8 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_5 1459628 : 1522381 70 Mannheimia_phage(53.12%) portal,head,terminase,protease,tail,plate,integrase,capsid,tRNA attL 1471358:1471381|attR 1537911:1537934
DBSCAN-SWA_6 1607452 : 1619533 11 Acinetobacter_phage(42.86%) tRNA NA
DBSCAN-SWA_7 1627813 : 1634224 9 Haemophilus_phage(55.56%) head,terminase NA
DBSCAN-SWA_8 1637783 : 1659434 31 Mannheimia_phage(23.81%) integrase attL 1649852:1649868|attR 1665638:1665654
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage