Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027404 Helicobacter pylori strain FDAARGOS_300 chromosome, complete genome 3 crisprs cas3,cas14j 0 1 0 0

Results visualization

1. NZ_CP027404
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027404_1 4973-5174 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027404_2 763303-763410 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027404_3 785613-785719 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027404_1 1.2|5064|31|NZ_CP027404|PILER-CR 5064-5094 31 MK448589 Streptococcus satellite phage Javan632, complete genome 4592-4622 6 0.806
NZ_CP027404_1 1.2|5064|31|NZ_CP027404|PILER-CR 5064-5094 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752261-752291 7 0.774
NZ_CP027404_1 1.2|5064|31|NZ_CP027404|PILER-CR 5064-5094 31 U88974 Streptococcus thermophilus temperate bacteriophage O1205, complete genome 23169-23199 8 0.742
NZ_CP027404_1 1.2|5064|31|NZ_CP027404|PILER-CR 5064-5094 31 NC_004303 Streptococcus phage O1205, complete genome 23169-23199 8 0.742

1. spacer 1.2|5064|31|NZ_CP027404|PILER-CR matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 6, identity: 0.806

cagcgc-ccaatccacttttgaaaacagcaat	CRISPR spacer
-accgtaccaatcgccttttgaaaacagcaag	Protospacer
 * **. ******  **************** 

2. spacer 1.2|5064|31|NZ_CP027404|PILER-CR matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 7, identity: 0.774

--cagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
atcaagg--caatctccttttgaaaacagcaac	Protospacer
  **. *  *****. ****************.

3. spacer 1.2|5064|31|NZ_CP027404|PILER-CR matches to U88974 (Streptococcus thermophilus temperate bacteriophage O1205, complete genome) position: , mismatch: 8, identity: 0.742

cagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
tagcgcccaaaacacttttgaaaactgatcc	Protospacer
.*********  ************* *   .

4. spacer 1.2|5064|31|NZ_CP027404|PILER-CR matches to NC_004303 (Streptococcus phage O1205, complete genome) position: , mismatch: 8, identity: 0.742

cagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
tagcgcccaaaacacttttgaaaactgatcc	Protospacer
.*********  ************* *   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage