Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021260 Legionella pneumophila strain NY24 (D-7706) chromosome, complete genome 3 crisprs cas2,cas1,cas9,cas4,cas3,DEDDh,DinG,WYL,csa3 0 3 4 0

Results visualization

1. NZ_CP021260
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021260_1 189550-190452 TypeII NA
12 spacers
cas4,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021260_2 224773-225675 TypeII NA
12 spacers
cas4,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021260_3 3212630-3212732 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_AP019741 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA1, complete sequence 181525-181555 7 0.774
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 CP032137 Acinetobacter haemolyticus strain sz1652 plasmid unnamed2, complete sequence 12732-12762 7 0.774
NZ_CP021260_1 1.4|189804|37|NZ_CP021260|CRISPRCasFinder,CRT,PILER-CR 189804-189840 37 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1503160-1503196 8 0.784
NZ_CP021260_2 2.4|225027|37|NZ_CP021260|CRISPRCasFinder,CRT,PILER-CR 225027-225063 37 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1503160-1503196 8 0.784
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_CP023033 Acinetobacter baumannii strain 7847 plasmid pAba7847b, complete sequence 13176-13206 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_CP015366 Acinetobacter baumannii strain 3207 plasmid pAba3207b, complete sequence 13176-13206 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 CP046596 Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence 85188-85218 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_CP038264 Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr6, complete sequence 10129-10159 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_CP033245 Acinetobacter baumannii strain 7835 plasmid pAba7835b, complete sequence 13175-13205 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_CP023028 Acinetobacter baumannii strain 10042 plasmid pAba10042b, complete sequence 45800-45830 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_CP042365 Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence 58146-58176 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 NZ_KX118105 Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence 41991-42021 8 0.742
NZ_CP021260_3 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder 3212666-3212696 31 HG796278 Uncultured bacterium plasmid pRGI00192 2532-2562 9 0.71

1. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_AP019741 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA1, complete sequence) position: , mismatch: 7, identity: 0.774

ttctattattatatctaactattgcaaaatt	CRISPR spacer
ttattgcataatatttaactattgcaaaata	Protospacer
** *  .** ****.*************** 

2. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to CP032137 (Acinetobacter haemolyticus strain sz1652 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

ttctattattatatctaactattgcaaaatt	CRISPR spacer
ttattgcataatatttaactattgcaaaata	Protospacer
** *  .** ****.*************** 

3. spacer 1.4|189804|37|NZ_CP021260|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

tcagggag---gggcagtgaaaattatggcaaacaagaac	CRISPR spacer
---aggagcccgggcagtgaaaattacggcaaacaagggg	Protospacer
   .****   ***************.**********.. 

4. spacer 2.4|225027|37|NZ_CP021260|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

tcagggag---gggcagtgaaaattatggcaaacaagaac	CRISPR spacer
---aggagcccgggcagtgaaaattacggcaaacaagggg	Protospacer
   .****   ***************.**********.. 

5. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_CP023033 (Acinetobacter baumannii strain 7847 plasmid pAba7847b, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

6. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_CP015366 (Acinetobacter baumannii strain 3207 plasmid pAba3207b, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

7. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to CP046596 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-1, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

8. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_CP038264 (Acinetobacter baumannii strain LEV1449/17Ec plasmid pEC_gr6, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

9. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_CP033245 (Acinetobacter baumannii strain 7835 plasmid pAba7835b, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

10. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_CP023028 (Acinetobacter baumannii strain 10042 plasmid pAba10042b, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

11. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_CP042365 (Acinetobacter pittii strain C54 plasmid pC54_001, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

12. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to NZ_KX118105 (Acinetobacter baumannii strain IHIT7853 plasmid IHIT7853-OXA-23, complete sequence) position: , mismatch: 8, identity: 0.742

ttctattattatatctaactattgcaaaatt	CRISPR spacer
taattgcataatatttaactattgcaaaata	Protospacer
*  *  .** ****.*************** 

13. spacer 3.1|3212666|31|NZ_CP021260|CRISPRCasFinder matches to HG796278 (Uncultured bacterium plasmid pRGI00192) position: , mismatch: 9, identity: 0.71

ttctattattatatctaactattgcaaaatt	CRISPR spacer
ccgcatttttatatccaactattgcaataaa	Protospacer
.. .*** *******.*********** *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1010698 : 1017537 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_2 1332558 : 1338496 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 2275215 : 2285332 7 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_4 2784541 : 2836131 52 Burkholderia_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage