Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021263 Legionella pneumophila subsp. fraseri strain D-3137 chromosome, complete genome 3 crisprs cas2,cas1,cas9,RT,cas3,PD-DExK,DinG,DEDDh,WYL,csa3 0 2 5 0

Results visualization

1. NZ_CP021263
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021263_1 200541-201302 TypeII NA
10 spacers
cas4,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021263_2 1732658-1732778 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021263_3 2666689-2666861 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021263_3 3.2|2666791|40|NZ_CP021263|CRISPRCasFinder 2666791-2666830 40 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257698 1 0.975
NZ_CP021263_1 1.9|201159|34|NZ_CP021263|CRISPRCasFinder,CRT,PILER-CR 201159-201192 34 NZ_CP016745 Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence 102474-102507 10 0.706
NZ_CP021263_1 1.9|201159|34|NZ_CP021263|CRISPRCasFinder,CRT,PILER-CR 201159-201192 34 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 172093-172126 10 0.706

1. spacer 3.2|2666791|40|NZ_CP021263|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 1, identity: 0.975

atggtgaattaatgcaaaaaaatgcaataataaatttatt	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttatt	Protospacer
****************** *********************

2. spacer 1.9|201159|34|NZ_CP021263|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016745 (Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence) position: , mismatch: 10, identity: 0.706

cggctggtattacaaggatgcaagacacatggat	CRISPR spacer
caaaaataattacaaggaggcaagagacatggct	Protospacer
*..  .  ********** ****** ****** *

3. spacer 1.9|201159|34|NZ_CP021263|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 10, identity: 0.706

cggctggtattacaaggatgcaagacacatggat	CRISPR spacer
caaaaataattacaaggaggcaagagacatggct	Protospacer
*..  .  ********** ****** ****** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 844748 : 913185 51 Escherichia_phage(12.5%) transposase,holin,tRNA NA
DBSCAN-SWA_2 941491 : 972351 26 Leptospira_phage(25.0%) transposase,tRNA NA
DBSCAN-SWA_3 1026788 : 1033672 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_4 1282432 : 1291928 9 Staphylococcus_phage(42.86%) NA NA
DBSCAN-SWA_5 2238149 : 2248265 7 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage