Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021258 Legionella pneumophila subsp. fraseri strain D-5744 chromosome, complete genome 3 crisprs cas2,cas1,cas9,RT,cas3,PD-DExK,DinG,DEDDh,WYL,csa3 0 1 3 0

Results visualization

1. NZ_CP021258
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021258_1 200541-201231 TypeII NA
9 spacers
cas4,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021258_2 1742940-1743060 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021258_3 2677034-2677206 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021258_3 3.2|2677136|40|NZ_CP021258|CRISPRCasFinder 2677136-2677175 40 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257698 1 0.975

1. spacer 3.2|2677136|40|NZ_CP021258|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 1, identity: 0.975

atggtgaattaatgcaaaaaaatgcaataataaatttatt	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttatt	Protospacer
****************** *********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1037073 : 1043956 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_2 1292716 : 1302212 9 Staphylococcus_phage(42.86%) NA NA
DBSCAN-SWA_3 2248496 : 2258612 7 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage