Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 0 crisprs NA 0 0 1 0
NZ_CP027369 Escherichia coli strain 2014C-3307 plasmid unnamed1, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP027368 Escherichia coli strain 2014C-3307 chromosome, complete genome 7 crisprs c2c9_V-U4,DEDDh,DinG,cas3,csa3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 19 10 0

Results visualization

1. NZ_CP027370
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29419 : 88302 39 Stx2-converting_phage(30.77%) transposase,integrase attL 23117:23133|attR 95360:95376

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP027369
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 141 : 108649 122 Salmonella_phage(84.82%) portal,tail,integrase,capsid,tRNA attL 96650:96667|attR 106685:106702

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP027368
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_1 875853-875976 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_2 1999932-2000077 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_3 2239368-2239464 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_4 2529090-2529183 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_5 4236389-4236506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_6 4631518-4632095 Unclear I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027368_7 4657795-4658187 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027368_4 4.1|2529120|34|NZ_CP027368|CRISPRCasFinder 2529120-2529153 34 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 9856-9889 0 1.0
NZ_CP027368_1 1.1|875896|38|NZ_CP027368|CRISPRCasFinder 875896-875933 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP027368_7 7.11|4658127|33|NZ_CP027368|CRT 4658127-4658159 33 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246936-246968 3 0.909
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 39364-39395 5 0.844
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 99-130 6 0.812
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 97059-97090 7 0.781
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 362913-362944 7 0.781
NZ_CP027368_6 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT 4632035-4632066 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP027368_6 6.16|4631913|34|NZ_CP027368|PILER-CR 4631913-4631946 34 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 447778-447811 7 0.794
NZ_CP027368_4 4.1|2529120|34|NZ_CP027368|CRISPRCasFinder 2529120-2529153 34 NZ_CP010866 Marinovum algicola DG 898 plasmid pMaD11, complete sequence 5770-5803 8 0.765
NZ_CP027368_6 6.1|4631547|32|NZ_CP027368|CRISPRCasFinder,CRT 4631547-4631578 32 MK972713 Salmonella phage SW5, complete genome 18872-18903 8 0.75
NZ_CP027368_6 6.1|4631547|32|NZ_CP027368|CRISPRCasFinder,CRT 4631547-4631578 32 MK972714 Salmonella phage SW3, complete genome 19094-19125 8 0.75
NZ_CP027368_6 6.1|4631547|32|NZ_CP027368|CRISPRCasFinder,CRT 4631547-4631578 32 NC_049460 Salmonella phage SI7, complete genome 9314-9345 8 0.75
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57773 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 376196-376227 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 MH155873 Microbacterium phage Paschalis, complete genome 25033-25064 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 546692-546723 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 202063-202094 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 86816-86847 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 570824-570855 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 500613-500644 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 162469-162500 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 89306-89337 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 638043-638074 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1365174-1365205 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 124144-124175 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 496002-496033 8 0.75
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 767196-767227 8 0.75
NZ_CP027368_6 6.8|4631974|32|NZ_CP027368|CRISPRCasFinder,CRT 4631974-4632005 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP027368_6 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT 4632035-4632066 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP027368_6 6.16|4631913|34|NZ_CP027368|PILER-CR 4631913-4631946 34 NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 97-130 8 0.765
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 MK448792 Streptococcus phage Javan521, complete genome 5597-5627 8 0.742
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 NC_009018 Streptococcus phage phi3396, complete genome 4848-4878 8 0.742
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 NC_004584 Streptococcus prophage 315.1, complete genome 5701-5731 8 0.742
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 MK448770 Streptococcus phage Javan477, complete genome 5597-5627 8 0.742
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 MK448978 Streptococcus phage Javan532, complete genome 5596-5626 8 0.742
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 MK448785 Streptococcus phage Javan507, complete genome 5596-5626 8 0.742
NZ_CP027368_7 7.2|4657884|32|NZ_CP027368|CRISPRCasFinder,PILER-CR 4657884-4657915 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
NZ_CP027368_7 7.4|4658006|32|NZ_CP027368|CRISPRCasFinder,PILER-CR 4658006-4658037 32 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9223 8 0.75
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 MK448792 Streptococcus phage Javan521, complete genome 5596-5627 8 0.75
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 NC_009018 Streptococcus phage phi3396, complete genome 4847-4878 8 0.75
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 NC_004584 Streptococcus prophage 315.1, complete genome 5700-5731 8 0.75
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 MK448770 Streptococcus phage Javan477, complete genome 5596-5627 8 0.75
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 MK448978 Streptococcus phage Javan532, complete genome 5595-5626 8 0.75
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 MK448785 Streptococcus phage Javan507, complete genome 5595-5626 8 0.75
NZ_CP027368_7 7.11|4658127|33|NZ_CP027368|CRT 4658127-4658159 33 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428129 8 0.758
NZ_CP027368_6 6.4|4631730|32|NZ_CP027368|CRISPRCasFinder,CRT 4631730-4631761 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52228 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60757-60788 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41217-41248 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-728 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41217-41248 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184797 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54225-54256 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46038-46069 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51662-51693 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26853 9 0.719
NZ_CP027368_6 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT 4631791-4631822 32 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145953-145984 9 0.719
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 447780-447811 9 0.719
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 335975-336006 9 0.719
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 207494-207525 9 0.719
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 226955-226986 9 0.719
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 NZ_CP014519 Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence 62779-62810 9 0.719
NZ_CP027368_6 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT 4631913-4631944 32 MH834603 Arthrobacter phage Bridgette, complete genome 29555-29586 9 0.719
NZ_CP027368_6 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT 4632035-4632066 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57775 9 0.735
NZ_CP027368_6 6.16|4631913|34|NZ_CP027368|PILER-CR 4631913-4631946 34 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 97059-97092 9 0.735
NZ_CP027368_6 6.16|4631913|34|NZ_CP027368|PILER-CR 4631913-4631946 34 MH155873 Microbacterium phage Paschalis, complete genome 25033-25066 9 0.735
NZ_CP027368_7 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder 4657824-4657854 31 MK448679 Streptococcus phage Javan137, complete genome 5205-5235 9 0.71
NZ_CP027368_7 7.2|4657884|32|NZ_CP027368|CRISPRCasFinder,PILER-CR 4657884-4657915 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
NZ_CP027368_6 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT 4632035-4632066 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP027368_6 6.10|4631547|34|NZ_CP027368|PILER-CR 4631547-4631580 34 MK972713 Salmonella phage SW5, complete genome 18872-18905 10 0.706
NZ_CP027368_6 6.10|4631547|34|NZ_CP027368|PILER-CR 4631547-4631580 34 MK972714 Salmonella phage SW3, complete genome 19094-19127 10 0.706
NZ_CP027368_6 6.10|4631547|34|NZ_CP027368|PILER-CR 4631547-4631580 34 NC_049460 Salmonella phage SI7, complete genome 9314-9347 10 0.706
NZ_CP027368_6 6.13|4631730|34|NZ_CP027368|PILER-CR 4631730-4631763 34 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52230 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-730 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184799 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26855 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60755-60788 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41215-41248 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41215-41248 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54223-54256 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46036-46069 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51660-51693 10 0.706
NZ_CP027368_6 6.14|4631791|34|NZ_CP027368|PILER-CR 4631791-4631824 34 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145951-145984 10 0.706
NZ_CP027368_6 6.18|4632035|34|NZ_CP027368|PILER-CR 4632035-4632068 34 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15451 10 0.706
NZ_CP027368_7 7.6|4657823|32|NZ_CP027368|CRT 4657823-4657854 32 MK448679 Streptococcus phage Javan137, complete genome 5204-5235 10 0.688
NZ_CP027368_7 7.7|4657883|33|NZ_CP027368|CRT 4657883-4657915 33 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35739-35771 10 0.697
NZ_CP027368_7 7.11|4658127|33|NZ_CP027368|CRT 4658127-4658159 33 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141310 10 0.697
NZ_CP027368_6 6.18|4632035|34|NZ_CP027368|PILER-CR 4632035-4632068 34 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139208-139241 11 0.676

1. spacer 4.1|2529120|34|NZ_CP027368|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 0, identity: 1.0 

cgcaccgcttttctccctctccccaaaggagcct	CRISPR spacer
cgcaccgcttttctccctctccccaaaggagcct	Protospacer
**********************************

2. spacer 1.1|875896|38|NZ_CP027368|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 7.11|4658127|33|NZ_CP027368|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.909 

gggcgcactggatgcgatgatggatatcactta	CRISPR spacer
ggacgcactggatgcgatgatggacatcacttg	Protospacer
**.*********************.*******.

4. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.844 

--tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
agtcg--gcggtgagcgcggcgtcgctcaggatg	Protospacer
  ***  ******.***********.*******

5. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 6, identity: 0.812 

tcggtg-cggtgggcgcggcgtcgttcaggatc	CRISPR spacer
-cgtcgtcggtggtctcggcgtcgttcaggatg	Protospacer
 ** .* ****** * ****************

6. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 7, identity: 0.781 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tggcgacggtgggcgcggcctcgtccaggagc	Protospacer
* *  .************* ****.***** *

7. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 7, identity: 0.781 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
ccagtccggcgggcgcggcgtcgttctcgaac	Protospacer
.*.** ***.****************  ** *

8. spacer 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

9. spacer 6.16|4631913|34|NZ_CP027368|PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 7, identity: 0.794 

tcggtgcggtgggcgcggcgtcgttcaggatcgt--	CRISPR spacer
gcggtgcggtgggcgcgtcgtcgctc--tatcatct	Protospacer
 **************** *****.**   ***.*

10. spacer 4.1|2529120|34|NZ_CP027368|CRISPRCasFinder matches to NZ_CP010866 (Marinovum algicola DG 898 plasmid pMaD11, complete sequence) position: , mismatch: 8, identity: 0.765 

cgca-ccgcttttctccctctccccaaaggagcct	CRISPR spacer
-gcacccgcttttctccctcgccacaaagccggac	Protospacer
 *** *************** ** *****  *  .

11. spacer 6.1|4631547|32|NZ_CP027368|CRISPRCasFinder,CRT matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 8, identity: 0.75 

acaaatgacactgagtgaaaagcagcagcgat	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt	Protospacer
   ***** ************.*****.*  *

12. spacer 6.1|4631547|32|NZ_CP027368|CRISPRCasFinder,CRT matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 8, identity: 0.75 

acaaatgacactgagtgaaaagcagcagcgat	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt	Protospacer
   ***** ************.*****.*  *

13. spacer 6.1|4631547|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 8, identity: 0.75 

acaaatgacactgagtgaaaagcagcagcgat	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt	Protospacer
   ***** ************.*****.*  *

14. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 8, identity: 0.75 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttc	Protospacer
 *   *. ******** *********** ***

15. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

16. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tcgccgcggtgggcgcggcgtcgtatcggtcg	Protospacer
*** .******************* . ** .

17. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *

18. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tgggtgcgctgggcgcggcctcgttgtcggtg	Protospacer
* ****** ********** *****   *.*

19. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcaag	Protospacer
 *.*.***.*** *************** *

20. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *

21. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *

22. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

23. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

24. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg	Protospacer
 *.* ***.*** *************** *

25. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

26. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

27. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

28. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg	Protospacer
 *.*.***.*** *************** *

29. spacer 6.8|4631974|32|NZ_CP027368|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

30. spacer 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

31. spacer 6.16|4631913|34|NZ_CP027368|PILER-CR matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggtg-cggtgggcgcggcgtcgttcaggatcgt	CRISPR spacer
-cgtcgtcggtggtctcggcgtcgttcaggatgtc	Protospacer
 ** .* ****** * ****************  .

32. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to MK448792 (Streptococcus phage Javan521, complete genome) position: , mismatch: 8, identity: 0.742 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttag	Protospacer
 *. ******** ****.*********  *

33. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to NC_009018 (Streptococcus phage phi3396, complete genome) position: , mismatch: 8, identity: 0.742 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttag	Protospacer
 *. ******** ****.*********  *

34. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 8, identity: 0.742 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttag	Protospacer
 *. ******** ****.*********  *

35. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to MK448770 (Streptococcus phage Javan477, complete genome) position: , mismatch: 8, identity: 0.742 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttag	Protospacer
 *. ******** ****.*********  *

36. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 8, identity: 0.742 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttag	Protospacer
 *. ******** ****.*********  *

37. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 8, identity: 0.742 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttag	Protospacer
 *. ******** ****.*********  *

38. spacer 7.2|4657884|32|NZ_CP027368|CRISPRCasFinder,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75 

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

39. spacer 7.4|4658006|32|NZ_CP027368|CRISPRCasFinder,PILER-CR matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75 

tccgtttggtccaccaaatgtttgatgcttca	CRISPR spacer
tcttatcaatccaccaaatttttgattcttca	Protospacer
**.  *...********** ****** *****

40. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to MK448792 (Streptococcus phage Javan521, complete genome) position: , mismatch: 8, identity: 0.75 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
aatggatatttccacaacaagtaattttttag	Protospacer
* *. ******** ****.*********  *

41. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to NC_009018 (Streptococcus phage phi3396, complete genome) position: , mismatch: 8, identity: 0.75 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
aatggatatttccacaacaagtaattttttag	Protospacer
* *. ******** ****.*********  *

42. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 8, identity: 0.75 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
aatggatatttccacaacaagtaattttttag	Protospacer
* *. ******** ****.*********  *

43. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to MK448770 (Streptococcus phage Javan477, complete genome) position: , mismatch: 8, identity: 0.75 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
aatggatatttccacaacaagtaattttttag	Protospacer
* *. ******** ****.*********  *

44. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 8, identity: 0.75 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
aatggatatttccacaacaagtaattttttag	Protospacer
* *. ******** ****.*********  *

45. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 8, identity: 0.75 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
aatggatatttccacaacaagtaattttttag	Protospacer
* *. ******** ****.*********  *

46. spacer 7.11|4658127|33|NZ_CP027368|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.758 

gggcgcactggatgcgatgatggata---tcactta	CRISPR spacer
gggcgcactggaagcggtgatggaggggcgcac---	Protospacer
************ ***.******* .    ***

47. spacer 6.4|4631730|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgatcacacgctcccacgggccgtaccagtc	CRISPR spacer
ttcggcagccgctcccaccggccggaccagtc	Protospacer
.. . **  ********* ***** *******

48. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

49. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

50. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

51. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

52. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

53. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

54. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

55. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

56. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

57. spacer 6.5|4631791|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 9, identity: 0.719 

atgatttttgcacgacgttcaaccggcgtttc	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc	Protospacer
     *. ******** *********** ***

58. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
gcggtgcggtgggcgcgtcgtcgctctatcat	Protospacer
 **************** *****.** .   .

59. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tcggtgcggtgtgcgcggcggcggcggcggac	Protospacer
*********** ******** ** . . *. *

60. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
aggtcgtggtgggcgcggcgtcctgcaggaag	Protospacer
  * .*.*************** * *****

61. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
ggggtgcgggcggcgcggcgtcgttggtgact	Protospacer
  *******  ************** . **..

62. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP014519 (Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
gcaatgccgtgggcgcgccgtcgttcatggga	Protospacer
 *..*** ********* ********* *.

63. spacer 6.7|4631913|32|NZ_CP027368|CRISPRCasFinder,CRT matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 9, identity: 0.719 

tcggtgcggtgggcgcggcgtcgttcaggatc	CRISPR spacer
tcgcttcggtgggcgcggcgtcgagggggccg	Protospacer
*** * *****************   .** .

64. spacer 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*

65. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 9, identity: 0.735 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttcga	Protospacer
 *   *. ******** *********** ****

66. spacer 6.16|4631913|34|NZ_CP027368|PILER-CR matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.735 

tcggtgcggtgggcgcggcgtcgttcaggatcgt	CRISPR spacer
tggcgacggtgggcgcggcctcgtccaggagctg	Protospacer
* *  .************* ****.***** *

67. spacer 6.16|4631913|34|NZ_CP027368|PILER-CR matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 9, identity: 0.735 

tcggtgcggtgggcgcggcgtcgttcaggatcgt	CRISPR spacer
tcgccgcggtgggcgcggcgtcgtatcggtcgct	Protospacer
*** .******************* . ** .  *

68. spacer 7.1|4657824|31|NZ_CP027368|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 9, identity: 0.71 

ctatatatttcctcaacgagtaattttgaat	CRISPR spacer
atggatatttccacaacaagtaattttttgg	Protospacer
 *. ******** ****.*********  .

69. spacer 7.2|4657884|32|NZ_CP027368|CRISPRCasFinder,PILER-CR matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719 

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

70. spacer 6.9|4632035|32|NZ_CP027368|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

71. spacer 6.10|4631547|34|NZ_CP027368|PILER-CR matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 10, identity: 0.706 

acaaatgacactgagtgaaaagcagcagcgatgt	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc	Protospacer
   ***** ************.*****.*  * .

72. spacer 6.10|4631547|34|NZ_CP027368|PILER-CR matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 10, identity: 0.706 

acaaatgacactgagtgaaaagcagcagcgatgt	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc	Protospacer
   ***** ************.*****.*  * .

73. spacer 6.10|4631547|34|NZ_CP027368|PILER-CR matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 10, identity: 0.706 

acaaatgacactgagtgaaaagcagcagcgatgt	CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc	Protospacer
   ***** ************.*****.*  * .

74. spacer 6.13|4631730|34|NZ_CP027368|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706 

ccgatcacacgctcccacgggccgtaccagtcgt	CRISPR spacer
ttcggcagccgctcccaccggccggaccagtcga	Protospacer
.. . **  ********* ***** ********

75. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

76. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

77. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

78. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

79. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

80. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

81. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

82. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

83. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

84. spacer 6.14|4631791|34|NZ_CP027368|PILER-CR matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 10, identity: 0.706 

atgatttttgcacgacgttcaaccggcgtttcgt	CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttcga	Protospacer
     *. ******** *********** ****

85. spacer 6.18|4632035|34|NZ_CP027368|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706 

gacgccgccgccgcgaagccgtttccgatgttga	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcccc	Protospacer
* ************* **** *****.  *..

86. spacer 7.6|4657823|32|NZ_CP027368|CRT matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 10, identity: 0.688 

actatatatttcctcaacgagtaattttgaat	CRISPR spacer
gatggatatttccacaacaagtaattttttgg	Protospacer
. *. ******** ****.*********  .

87. spacer 7.7|4657883|33|NZ_CP027368|CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697 

ggtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
ccgagaccgcctcgccgaggcgctggcagcgac	Protospacer
     ******.*** *************   *

88. spacer 7.11|4658127|33|NZ_CP027368|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.697 

gggcgcactggatgcgatgatggatatcactta	CRISPR spacer
cggcgcactggaaccgatgatggatgcgatgag	Protospacer
 ***********  ***********.. *.  .

89. spacer 6.18|4632035|34|NZ_CP027368|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 11, identity: 0.676 

gacgccgccgccgcgaagccgtttccgatgttga	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccgggcc	Protospacer
** ************** ******..  .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 63120 : 144130 87 Enterobacteria_phage(70.37%) integrase,portal,protease,tRNA,capsid,tail,head,terminase,lysis attL 56242:56258|attR 115603:115619
DBSCAN-SWA_2 343634 : 353075 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 690633 : 761529 87 Shigella_phage(46.51%) integrase,protease,tRNA,transposase,head,plate,tail attL 743526:743540|attR 761582:761596
DBSCAN-SWA_4 905182 : 1033104 136 Shigella_phage(46.25%) integrase,holin,portal,protease,bacteriocin,tRNA,capsid,head,terminase,lysis attL 969057:969076|attR 996784:996803
DBSCAN-SWA_5 1259825 : 1327688 75 Escherichia_phage(27.45%) integrase,holin,protease,capsid,tail,head,terminase,lysis attL 1259662:1259686|attR 1313883:1313907
DBSCAN-SWA_6 1621935 : 1631319 10 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_7 1640241 : 1691902 65 Escherichia_phage(75.0%) holin,integrase,portal,bacteriocin,capsid,terminase,lysis attL 1622326:1622342|attR 1699873:1699889
DBSCAN-SWA_8 1831654 : 1914298 92 Salmonella_phage(63.46%) integrase,portal,protease,tRNA,capsid,tail,head,plate,terminase,lysis attL 1865130:1865144|attR 1916009:1916023
DBSCAN-SWA_9 3181894 : 3226909 52 Escherichia_phage(46.94%) integrase,holin,portal,tRNA,tail,terminase,lysis attL 3181945:3181959|attR 3221033:3221047
DBSCAN-SWA_10 4674482 : 4681622 6 Escherichia_phage(83.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage