Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027556 Escherichia coli strain 2013C-3513 plasmid unnamed2 0 crisprs NA 0 0 1 0
NZ_CP027555 Escherichia coli strain 2013C-3513 chromosome, complete genome 5 crisprs c2c9_V-U4,DEDDh,DinG,cas3,csa3,cas8e,cse2gr11,cas7,cas5,cas1,cas2,PrimPol 0 11 343 0
NZ_CP027554 Escherichia coli strain 2013C-3513 plasmid unnamed1 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP027556
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2277 : 87402 66 Stx2-converting_phage(40.0%) protease,transposase,integrase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP027555
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027555_1 1501397-1501541 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027555_2 2335249-2335381 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027555_3 3879477-3879594 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027555_4 4288711-4289288 Unclear I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027555_5 4314989-4315505 TypeI-E I-E
8 spacers
cas2,cas1,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027555_2 2.1|2335266|42|NZ_CP027555|PILER-CR 2335266-2335307 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP027555_2 2.2|2335325|40|NZ_CP027555|PILER-CR 2335325-2335364 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
NZ_CP027555_5 5.8|4315445|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315445-4315476 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP027555_4 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
NZ_CP027555_4 4.8|4289167|32|NZ_CP027555|CRISPRCasFinder,CRT 4289167-4289198 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP027555_4 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP027555_5 5.4|4315201|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315201-4315232 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
NZ_CP027555_4 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
NZ_CP027555_4 4.6|4289045|32|NZ_CP027555|CRISPRCasFinder,CRT 4289045-4289076 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
NZ_CP027555_4 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP027555_5 5.3|4315140|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315140-4315171 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
NZ_CP027555_5 5.3|4315140|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315140-4315171 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
NZ_CP027555_5 5.6|4315323|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315323-4315354 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
NZ_CP027555_4 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP027555_5 5.2|4315079|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315079-4315110 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
NZ_CP027555_5 5.4|4315201|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315201-4315232 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688
NZ_CP027555_5 5.2|4315079|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT 4315079-4315110 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 2.1|2335266|42|NZ_CP027555|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 2.2|2335325|40|NZ_CP027555|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95 

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

3. spacer 5.8|4315445|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

4. spacer 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

5. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcacc	Protospacer
**...*********** *** *******.* .

6. spacer 4.8|4289167|32|NZ_CP027555|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

7. spacer 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

8. spacer 5.4|4315201|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75 

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
aattcacgatcatctttgattatccgcgaaga	Protospacer
.*  *  .****** *******.*********

9. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

10. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

11. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

12. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

13. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

14. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

15. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

16. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

17. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

18. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

19. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

20. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

21. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

22. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

23. spacer 4.1|4288740|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

24. spacer 4.6|4289045|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

25. spacer 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*

26. spacer 5.3|4315140|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaaaaacgccgtgatattgccgat	Protospacer
 **. **** *.****************   .

27. spacer 5.3|4315140|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaagaacgccgtgatgttgccggt	Protospacer
 **. **** *************.****   .

28. spacer 5.6|4315323|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719 

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

29. spacer 4.9|4289228|32|NZ_CP027555|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

30. spacer 5.2|4315079|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
gcgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
*. **** ***************.**..   .

31. spacer 5.4|4315201|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688 

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
tgggctgcatcatcattgattacctgcaactg	Protospacer
 ...*** ****************.**.*  .

32. spacer 5.2|4315079|32|NZ_CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
ccgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
 . **** ***************.**..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 54149 72 Enterobacteria_phage(32.86%) holin,tail,protease,head,terminase,capsid NA
DBSCAN-SWA_2 59269 : 60640 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_3 63776 : 67505 5 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_4 73372 : 75694 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_5 84212 : 85900 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_6 112659 : 115411 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_7 118547 : 122555 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_8 125656 : 125887 1 Spodoptera_litura_granulovirus(100.0%) NA NA
DBSCAN-SWA_9 137140 : 147151 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_10 156561 : 158576 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_11 166510 : 247165 87 Stx2-converting_phage(38.18%) holin,tail,protease,transposase,integrase,head,terminase,capsid attL 166347:166374|attR 230097:230124
DBSCAN-SWA_12 252088 : 252679 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_13 260494 : 266154 4 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_14 279069 : 280335 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_15 294326 : 295409 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_16 313589 : 314105 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_17 320430 : 379470 69 Escherichia_phage(39.06%) holin,tail,tRNA,integrase,head,terminase,capsid attL 312948:312963|attR 364116:364131
DBSCAN-SWA_18 384430 : 385420 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_19 416706 : 420609 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_20 424548 : 425497 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_21 437299 : 447472 9 Escherichia_phage(20.0%) transposase NA
DBSCAN-SWA_22 450853 : 451663 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_23 455928 : 458031 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_24 462938 : 469323 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_25 475717 : 477262 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_26 484147 : 484438 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_27 490450 : 491892 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_28 495166 : 497072 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_29 501388 : 505195 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_30 510474 : 517410 3 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_31 524719 : 633078 112 Escherichia_phage(28.81%) holin,tail,transposase,portal,head,integrase,terminase,capsid attL 513262:513278|attR 639715:639731
DBSCAN-SWA_32 637959 : 642524 4 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_33 649363 : 666146 23 uncultured_Caudovirales_phage(100.0%) protease,portal,head,integrase,terminase,capsid attL 654988:655003|attR 677325:677340
DBSCAN-SWA_34 675161 : 676463 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 686357 : 688169 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_36 708043 : 709318 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_37 716229 : 717728 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_38 726530 : 735334 9 Streptomyces_phage(20.0%) NA NA
DBSCAN-SWA_39 740837 : 743104 3 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_40 753856 : 756477 3 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_41 775067 : 794661 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_42 805958 : 808220 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_43 814558 : 815386 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_44 822862 : 824083 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_45 830847 : 831501 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_46 837099 : 839061 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 843987 : 844629 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_48 847872 : 848727 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_49 852045 : 856622 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_50 862573 : 958624 106 Escherichia_phage(34.92%) holin,tail,protease,tRNA,transposase,portal,head,lysis,integrase,capsid attL 902079:902093|attR 958627:958641
DBSCAN-SWA_51 966680 : 968156 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_52 981734 : 982862 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_53 990324 : 997388 9 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_54 1001406 : 1077375 84 Enterobacteria_phage(73.91%) holin,tail,plate,tRNA,portal,integrase,head,terminase,capsid attL 1040988:1041047|attR 1078318:1078438
DBSCAN-SWA_55 1083630 : 1084383 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_56 1096183 : 1096852 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_57 1114995 : 1123341 8 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_58 1126885 : 1127416 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_59 1166060 : 1168373 3 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_60 1178095 : 1180254 4 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_61 1184595 : 1185762 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_62 1193406 : 1194306 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_63 1201663 : 1222957 20 Moumouvirus(18.18%) NA NA
DBSCAN-SWA_64 1228862 : 1235656 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_65 1239900 : 1250376 8 uncultured_marine_virus(20.0%) NA NA
DBSCAN-SWA_66 1255101 : 1256454 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_67 1270302 : 1276416 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_68 1285638 : 1289195 4 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_69 1299841 : 1301875 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_70 1315573 : 1326178 11 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_71 1346511 : 1348032 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_72 1351726 : 1355512 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_73 1359581 : 1360439 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_74 1365712 : 1366531 1 Acinetobacter_phage(100.0%) transposase NA
DBSCAN-SWA_75 1376201 : 1380502 4 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_76 1386256 : 1499913 126 Enterobacteria_phage(37.8%) holin,tail,protease,transposase,portal,integrase,head,lysis,terminase attL 1433607:1433622|attR 1501460:1501475
DBSCAN-SWA_77 1509716 : 1516289 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_78 1520644 : 1524164 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_79 1560254 : 1561046 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_80 1564424 : 1567366 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_81 1571450 : 1584171 8 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_82 1590826 : 1591591 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_83 1595740 : 1599554 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_84 1604180 : 1605845 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_85 1609941 : 1611021 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_86 1618917 : 1622450 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_87 1629388 : 1631971 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_88 1638981 : 1641421 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_89 1646236 : 1646884 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_90 1662309 : 1664424 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_91 1667533 : 1669356 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_92 1683896 : 1689939 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_93 1701367 : 1704511 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_94 1707781 : 1776728 77 Enterobacteria_phage(58.33%) tail,protease,transposase,portal,head,lysis,integrase,terminase,capsid attL 1727869:1727915|attR 1776742:1776788
DBSCAN-SWA_95 1783817 : 1786948 4 Enterococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_96 1798367 : 1799513 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_97 1805702 : 1807484 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_98 1819794 : 1820481 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_99 1823617 : 1824295 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_100 1828834 : 1831794 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_101 1840037 : 1848599 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_102 1856886 : 1860036 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_103 1868871 : 1872418 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_104 1875741 : 1876437 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_105 1879565 : 1884612 4 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_106 1908444 : 1917425 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_107 1924377 : 1934348 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_108 1938637 : 1939753 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_109 1951754 : 1952621 1 Acinetobacter_phage(100.0%) transposase NA
DBSCAN-SWA_110 1956543 : 1957311 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_111 1962608 : 1963718 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1966896 : 1968857 2 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_113 1974267 : 1978547 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_114 1982387 : 1988084 4 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_115 1996460 : 2000998 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_116 2012991 : 2023467 5 Escherichia_phage(33.33%) holin NA
DBSCAN-SWA_117 2029042 : 2032347 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_118 2048879 : 2050036 1 Acinetobacter_phage(100.0%) transposase NA
DBSCAN-SWA_119 2058368 : 2062080 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_120 2066757 : 2067897 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_121 2091159 : 2094117 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_122 2111318 : 2111897 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_123 2125295 : 2128079 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_124 2138556 : 2146409 9 Bradyrhizobium_phage(25.0%) NA NA
DBSCAN-SWA_125 2153067 : 2154099 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_126 2168336 : 2172452 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_127 2199985 : 2200330 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_128 2206241 : 2207039 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_129 2212218 : 2219024 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_130 2228930 : 2229833 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_131 2233095 : 2239563 5 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_132 2247212 : 2248637 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_133 2257264 : 2257816 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_134 2262061 : 2263105 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_135 2290357 : 2292082 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_136 2304784 : 2305483 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_137 2311815 : 2317238 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_138 2324982 : 2327736 5 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_139 2335631 : 2341292 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_140 2346762 : 2347911 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_141 2352317 : 2355134 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_142 2362176 : 2371244 9 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_143 2383013 : 2385127 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_144 2388410 : 2393765 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_145 2400508 : 2401831 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_146 2407870 : 2410746 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_147 2418671 : 2419951 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_148 2430565 : 2432230 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_149 2448839 : 2452808 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_150 2459370 : 2460315 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_151 2467816 : 2468371 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_152 2474940 : 2476401 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_153 2485528 : 2487205 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_154 2490567 : 2491548 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_155 2495176 : 2496438 3 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_156 2508663 : 2597357 77 Stx2-converting_phage(37.14%) tRNA,transposase,integrase,protease attL 2542441:2542454|attR 2554585:2554598
DBSCAN-SWA_157 2619358 : 2621189 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_158 2632757 : 2691046 56 Vibrio_phage(15.38%) tRNA,transposase,integrase,protease attL 2658254:2658268|attR 2690315:2690329
DBSCAN-SWA_159 2696581 : 2697571 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_160 2732844 : 2734383 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_161 2745157 : 2745736 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_162 2752736 : 2755948 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_163 2777144 : 2778647 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_164 2783486 : 2784275 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_165 2789879 : 2791429 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_166 2795414 : 2797400 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_167 2802645 : 2804793 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_168 2814075 : 2816034 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_169 2821619 : 2822969 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_170 2826786 : 2830398 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_171 2835736 : 2837152 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_172 2843742 : 2844351 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_173 2853566 : 2854682 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_174 2870688 : 2871480 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_175 2883360 : 2887044 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_176 2902418 : 2904008 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2909376 : 2911140 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_178 2920356 : 2928685 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_179 2932801 : 2935854 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_180 2944358 : 2946203 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_181 2963238 : 2970485 6 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_182 2986033 : 2990218 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_183 2995855 : 3000358 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_184 3011931 : 3016791 4 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_185 3032615 : 3035666 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_186 3045818 : 3048598 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_187 3063546 : 3066017 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_188 3070095 : 3072882 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_189 3086562 : 3087177 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_190 3095967 : 3099254 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_191 3111666 : 3113496 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_192 3120981 : 3124840 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_193 3127876 : 3130677 2 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_194 3146961 : 3153105 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_195 3157146 : 3162558 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_196 3171031 : 3172678 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_197 3186069 : 3191922 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_198 3195090 : 3196083 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_199 3208034 : 3211396 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_200 3218755 : 3222596 4 Cyanophage(50.0%) NA NA
DBSCAN-SWA_201 3233586 : 3234924 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_202 3245122 : 3252491 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_203 3257197 : 3258346 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_204 3262772 : 3263726 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_205 3270079 : 3279241 10 Aeromonas_phage(25.0%) NA NA
DBSCAN-SWA_206 3286663 : 3287998 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_207 3300114 : 3301506 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_208 3306627 : 3313378 6 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_209 3316751 : 3321314 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_210 3333245 : 3343986 10 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_211 3365791 : 3375929 6 uncultured_Caudovirales_phage(66.67%) tRNA NA
DBSCAN-SWA_212 3400117 : 3401659 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_213 3406976 : 3407972 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_214 3412195 : 3412408 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_215 3416062 : 3418396 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_216 3435425 : 3437410 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_217 3484870 : 3485518 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_218 3490399 : 3492534 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_219 3495878 : 3497921 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_220 3511526 : 3514262 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_221 3517637 : 3523289 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_222 3531182 : 3535314 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_223 3538320 : 3541139 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_224 3546872 : 3548355 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_225 3551895 : 3553706 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_226 3573746 : 3576194 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_227 3585423 : 3586650 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_228 3591029 : 3593423 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_229 3599392 : 3600271 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_230 3606834 : 3610601 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_231 3627577 : 3628414 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_232 3652640 : 3662181 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_233 3667751 : 3673325 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_234 3693202 : 3694674 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_235 3705009 : 3710475 4 Bacillus_virus(33.33%) transposase NA
DBSCAN-SWA_236 3716979 : 3717864 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_237 3723200 : 3727713 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_238 3737755 : 3738799 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_239 3755295 : 3757820 2 uncultured_archaeal_virus(50.0%) protease NA
DBSCAN-SWA_240 3761786 : 3762284 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_241 3765989 : 3767480 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_242 3777406 : 3792200 16 Staphylococcus_phage(28.57%) NA NA
DBSCAN-SWA_243 3796268 : 3797745 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_244 3804373 : 3807246 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_245 3811328 : 3817967 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_246 3823448 : 3825338 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_247 3832444 : 3840237 10 Diadromus_pulchellus_ascovirus(25.0%) NA NA
DBSCAN-SWA_248 3863245 : 3864391 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_249 3872378 : 3874673 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_250 3900675 : 3901641 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_251 3914058 : 3930242 12 Herpes_simplex_virus(16.67%) tRNA NA
DBSCAN-SWA_252 3936624 : 3937863 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_253 3943000 : 3944434 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_254 3953949 : 3964911 12 Staphylococcus_phage(20.0%) NA NA
DBSCAN-SWA_255 3968738 : 3979561 9 Stx_converting_phage(25.0%) NA NA
DBSCAN-SWA_256 3985638 : 3986523 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_257 4010016 : 4011189 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_258 4025727 : 4026940 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_259 4031716 : 4032982 1 Pseudomonas_phage(100.0%) integrase attL 4025982:4025995|attR 4037517:4037530
DBSCAN-SWA_260 4058812 : 4059967 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_261 4080968 : 4081646 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_262 4099652 : 4100885 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_263 4109413 : 4114781 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_264 4118705 : 4134097 14 Brevibacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_265 4158376 : 4161546 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_266 4169489 : 4179807 8 Stx2-converting_phage(42.86%) transposase,integrase attL 4172750:4172766|attR 4181835:4181851
DBSCAN-SWA_267 4204527 : 4207022 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_268 4216653 : 4223426 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_269 4228902 : 4249781 14 Bacillus_phage(22.22%) tRNA NA
DBSCAN-SWA_270 4261307 : 4262153 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_271 4266921 : 4267770 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_272 4275304 : 4279419 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_273 4283451 : 4288371 5 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_274 4317785 : 4319818 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_275 4322928 : 4326644 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_276 4331858 : 4338998 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_277 4358455 : 4359469 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_278 4367042 : 4368008 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_279 4373474 : 4379034 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_280 4391851 : 4397147 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_281 4401082 : 4405207 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_282 4410465 : 4515225 103 Stx2-converting_phage(33.33%) holin,tail,tRNA,transposase,integrase,head,terminase,capsid attL 4413525:4413539|attR 4425885:4425899
DBSCAN-SWA_283 4518339 : 4519674 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_284 4525445 : 4529188 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_285 4532646 : 4532907 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_286 4537026 : 4548334 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_287 4554098 : 4555610 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 4570897 : 4577354 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_289 4587239 : 4587671 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_290 4596500 : 4602985 7 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_291 4609231 : 4613233 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_292 4634483 : 4635197 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_293 4653244 : 4654195 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_294 4672749 : 4677687 6 Deep-sea_thermophilic_phage(33.33%) NA NA
DBSCAN-SWA_295 4681165 : 4696535 15 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_296 4722229 : 4722964 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_297 4726782 : 4727703 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_298 4731394 : 4738971 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_299 4745624 : 4747058 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_300 4750528 : 4751790 3 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_301 4764118 : 4766734 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_302 4774651 : 4777676 3 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_303 4795549 : 4796635 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_304 4805190 : 4806327 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_305 4812803 : 4814321 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_306 4818532 : 4820393 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_307 4830952 : 4834180 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_308 4870513 : 4875517 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_309 4878669 : 4988435 123 Enterobacteria_phage(38.1%) holin,tail,protease,transposase,portal,integrase,lysis,head,terminase attL 4895919:4895953|attR 4982616:4982650
DBSCAN-SWA_310 4991975 : 4997200 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_311 5004172 : 5006355 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_312 5009484 : 5012611 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_313 5016503 : 5020634 3 Citrobacter_phage(50.0%) NA NA
DBSCAN-SWA_314 5037055 : 5038258 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_315 5046824 : 5055974 11 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_316 5059311 : 5062049 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_317 5065636 : 5067355 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_318 5076652 : 5100448 16 uncultured_Mediterranean_phage(16.67%) tRNA,protease NA
DBSCAN-SWA_319 5106757 : 5109972 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_320 5114070 : 5115159 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_321 5120245 : 5124786 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_322 5139491 : 5140040 1 Rhodobacter_phage(100.0%) NA NA
DBSCAN-SWA_323 5143589 : 5151903 5 Enterobacteria_phage(25.0%) tRNA NA
DBSCAN-SWA_324 5167824 : 5169732 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_325 5174399 : 5287379 145 Escherichia_phage(35.14%) holin,tail,protease,transposase,portal,integrase,head,terminase,capsid attL 5234594:5234619|attR 5285199:5285224
DBSCAN-SWA_326 5290416 : 5296881 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_327 5301187 : 5303287 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_328 5318187 : 5355123 34 Stx2-converting_phage(41.67%) transposase,integrase attL 5313238:5313252|attR 5323614:5323628
DBSCAN-SWA_329 5361488 : 5371982 9 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_330 5388012 : 5393157 7 Flavobacterium_phage(25.0%) transposase NA
DBSCAN-SWA_331 5404065 : 5404491 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_332 5414197 : 5416368 4 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_333 5422385 : 5423219 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_334 5427352 : 5427886 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_335 5437194 : 5438115 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_336 5442777 : 5443023 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_337 5458869 : 5459811 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_338 5472168 : 5473349 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_339 5476621 : 5478264 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_340 5490587 : 5490845 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_341 5498134 : 5501857 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_342 5505303 : 5555825 61 Stx2-converting_phage(34.62%) holin,tail,transposase,integrase,head,terminase,capsid attL 5500397:5500411|attR 5506878:5506892
DBSCAN-SWA_343 5574966 : 5584651 16 Enterobacteria_phage(33.33%) integrase attL 5569987:5570000|attR 5580877:5580890

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage