Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027586 Escherichia coli strain 2012EL-2448 chromosome, complete genome 3 crisprs DEDDh,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,DinG,c2c9_V-U4,WYL 0 4 334 0

Results visualization

1. NZ_CP027586
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027586_1 1142944-1143338 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027586_2 1169056-1169144 Unclear I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027586_3 4013354-4013499 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027586_1 1.6|1143278|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1143278-1143309 32 NC_028662 Mycobacterium phage Phlei, complete genome 44891-44922 5 0.844
NZ_CP027586_1 1.1|1142973|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1142973-1143004 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP027586_1 1.2|1143034|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1143034-1143065 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
NZ_CP027586_1 1.3|1143095|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1143095-1143126 32 NC_021529 Vibrio phage nt-1, complete genome 92167-92198 7 0.781
NZ_CP027586_1 1.2|1143034|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1143034-1143065 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
NZ_CP027586_1 1.2|1143034|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1143034-1143065 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
NZ_CP027586_1 1.3|1143095|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT 1143095-1143126 32 NZ_CP015355 Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence 26849-26880 9 0.719

1. spacer 1.6|1143278|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NC_028662 (Mycobacterium phage Phlei, complete genome) position: , mismatch: 5, identity: 0.844

-gaggtggcaatacgcgtagatcatttggtcgt	CRISPR spacer
agagctcgc-atacgcgtagagcgtttggtcgt	Protospacer
 *** * ** *********** *.*********

2. spacer 1.1|1142973|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 1.2|1143034|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..** 

4. spacer 1.3|1143095|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 7, identity: 0.781

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
gtcaacataatgagcaaaatcaacgtctctgt	Protospacer
* ********.**.*************  . *

5. spacer 1.2|1143034|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .* 

6. spacer 1.2|1143034|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **      

7. spacer 1.3|1143095|32|NZ_CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015355 (Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence) position: , mismatch: 9, identity: 0.719

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
tgcaacagaaccaacaaaatcaacattatatc	Protospacer
 ****** *** ************.*.*  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11826 10 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_2 21899 : 23414 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 35404 : 36157 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_4 48319 : 138091 105 Escherichia_phage(41.18%) capsid,head,holin,transposase,integrase,tail,terminase attL 54164:54178|attR 142689:142703
DBSCAN-SWA_5 165841 : 167008 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_6 174652 : 175552 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_7 182907 : 185729 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_8 191080 : 198700 8 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_9 204315 : 211108 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_10 215351 : 225827 8 uncultured_marine_virus(20.0%) NA NA
DBSCAN-SWA_11 230490 : 231843 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_12 244957 : 350356 110 Enterobacteria_phage(29.87%) capsid,head,holin,tRNA,integrase,tail,terminase attL 296864:296884|attR 347862:347882
DBSCAN-SWA_13 370671 : 372192 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_14 375886 : 376555 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_15 383741 : 384599 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_16 399130 : 403431 4 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_17 409962 : 529179 103 Escherichia_phage(39.06%) capsid,protease,portal,holin,bacteriocin,transposase,integrase,tail attL 440068:440084|attR 526820:526836
DBSCAN-SWA_18 543914 : 558010 8 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_19 563903 : 564806 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_20 567958 : 572962 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_21 607387 : 610615 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_22 621174 : 623035 2 Sodalis_phage(50.0%) NA NA
DBSCAN-SWA_23 627246 : 628764 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_24 644913 : 645999 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_25 663867 : 664800 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_26 673477 : 728024 70 Escherichia_phage(77.94%) capsid,portal,holin,integrase attL 664876:664899|attR 728220:728243
DBSCAN-SWA_27 731184 : 732618 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_28 743971 : 748203 3 Shigella_phage(50.0%) transposase NA
DBSCAN-SWA_29 751894 : 752815 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_30 756633 : 757368 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_31 783682 : 799052 15 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_32 802530 : 807468 6 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_33 826021 : 826972 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_34 845019 : 845733 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 867030 : 871032 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_36 877465 : 883762 6 Escherichia_phage(60.0%) NA NA
DBSCAN-SWA_37 892591 : 893023 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_38 903685 : 910142 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_39 925248 : 926760 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_40 932518 : 943808 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_41 947927 : 948188 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_42 951646 : 955389 3 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_43 960291 : 1042837 86 Salmonella_phage(73.47%) capsid,head,lysis,portal,tRNA,transposase,integrase,plate,tail,terminase attL 1004952:1004997|attR 1039115:1039160
DBSCAN-SWA_44 1052287 : 1056339 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_45 1060274 : 1065571 5 Oenococcus_phage(20.0%) NA NA
DBSCAN-SWA_46 1078620 : 1084180 5 Vibrio_phage(25.0%) tRNA NA
DBSCAN-SWA_47 1089646 : 1090612 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_48 1098087 : 1099101 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_49 1119448 : 1126588 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_50 1131802 : 1135518 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_51 1138630 : 1140663 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_52 1164531 : 1165317 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_53 1169483 : 1174403 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_54 1178435 : 1185483 4 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_55 1190084 : 1190933 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_56 1195791 : 1196547 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 1208073 : 1223460 9 environmental_halophage(16.67%) tRNA NA
DBSCAN-SWA_58 1228936 : 1235709 6 Geobacillus_virus(33.33%) NA NA
DBSCAN-SWA_59 1245340 : 1247835 2 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_60 1264227 : 1265501 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_61 1273534 : 1280870 10 Stx2-converting_phage(33.33%) NA NA
DBSCAN-SWA_62 1284726 : 1288261 4 Vibrio_phage(33.33%) integrase attL 1281049:1281062|attR 1289342:1289355
DBSCAN-SWA_63 1312540 : 1327932 14 environmental_Halophage(14.29%) tRNA NA
DBSCAN-SWA_64 1331856 : 1337224 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_65 1345751 : 1346984 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_66 1364990 : 1365668 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_67 1386669 : 1432119 44 Enterobacteria_phage(25.0%) transposase,integrase,protease,tRNA attL 1383059:1383074|attR 1437456:1437471
DBSCAN-SWA_68 1454179 : 1455352 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_69 1477566 : 1478451 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_70 1484294 : 1495117 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_71 1498944 : 1509906 11 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_72 1519421 : 1520855 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_73 1525992 : 1527231 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_74 1533613 : 1549797 12 Moraxella_phage(16.67%) tRNA NA
DBSCAN-SWA_75 1562218 : 1563184 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_76 1588922 : 1591217 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_77 1599204 : 1600350 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_78 1623997 : 1627921 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_79 1632916 : 1634211 3 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_80 1638895 : 1640785 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_81 1646266 : 1652905 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_82 1656986 : 1659859 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_83 1666487 : 1667964 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_84 1672032 : 1686826 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_85 1693575 : 1698323 5 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_86 1702028 : 1702526 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_87 1706492 : 1709017 2 uncultured_Mediterranean_phage(50.0%) protease NA
DBSCAN-SWA_88 1725513 : 1726557 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_89 1737122 : 1738007 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_90 1744347 : 1748501 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_91 1758833 : 1760305 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_92 1780182 : 1785756 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_93 1791326 : 1800867 9 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_94 1825095 : 1825932 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_95 1842906 : 1846674 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_96 1853237 : 1854116 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_97 1860085 : 1862479 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_98 1866858 : 1868085 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_99 1877315 : 1879763 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_100 1899774 : 1901585 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_101 1905122 : 1906608 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_102 1912341 : 1915160 3 Salicola_phage(50.0%) NA NA
DBSCAN-SWA_103 1918166 : 1922298 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_104 1930191 : 1936074 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_105 1949488 : 1951531 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_106 1954645 : 1956780 3 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_107 1961651 : 1962299 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_108 2009762 : 2011747 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_109 2027497 : 2029831 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_110 2033485 : 2033698 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_111 2037922 : 2038918 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_112 2044236 : 2045778 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_113 2070741 : 2081432 7 uncultured_Caudovirales_phage(66.67%) tRNA NA
DBSCAN-SWA_114 2103529 : 2114258 10 Rhizobium_phage(16.67%) NA NA
DBSCAN-SWA_115 2126965 : 2131528 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_116 2134868 : 2191831 44 Morganella_phage(15.79%) transposase,integrase,protease,tRNA attL 2144683:2144698|attR 2181944:2181959
DBSCAN-SWA_117 2198600 : 2201288 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_118 2207450 : 2209763 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_119 2227258 : 2229668 5 Yersinia_phage(33.33%) NA NA
DBSCAN-SWA_120 2238462 : 2239797 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_121 2247101 : 2256263 11 Micromonas_sp._RCC1109_virus(25.0%) NA NA
DBSCAN-SWA_122 2262616 : 2263570 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_123 2267997 : 2269146 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_124 2273852 : 2281221 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_125 2291418 : 2292756 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_126 2303745 : 2307586 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_127 2313117 : 2316479 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_128 2328431 : 2329424 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_129 2332592 : 2338445 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_130 2351834 : 2353481 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_131 2361896 : 2367308 4 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_132 2371350 : 2377494 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_133 2396014 : 2399873 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_134 2407357 : 2409187 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_135 2421599 : 2424886 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_136 2434955 : 2435570 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_137 2449253 : 2452040 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_138 2456118 : 2458589 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_139 2465759 : 2470490 5 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_140 2483214 : 2486265 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_141 2501040 : 2505901 5 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_142 2517475 : 2521978 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_143 2527615 : 2531800 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_144 2544792 : 2552039 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_145 2564157 : 2565372 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_146 2572112 : 2573957 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_147 2582462 : 2585515 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_148 2589631 : 2597960 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_149 2607176 : 2608940 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_150 2614308 : 2615898 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_151 2631268 : 2634952 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_152 2640602 : 2641394 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_153 2657201 : 2658317 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_154 2667532 : 2668141 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_155 2674737 : 2676153 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_156 2681491 : 2685104 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_157 2688921 : 2690271 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_158 2695855 : 2697814 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_159 2707097 : 2709245 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_160 2714490 : 2716476 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_161 2720461 : 2722077 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_162 2727681 : 2728470 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_163 2733308 : 2734811 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_164 2756006 : 2824987 58 Stx2-converting_phage(20.0%) transposase,tRNA NA
DBSCAN-SWA_165 2828639 : 2830130 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_166 2841041 : 2843025 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_167 2847536 : 2848070 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_168 2852990 : 2853968 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_169 2861953 : 2862499 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_170 2866414 : 2879445 11 Vibrio_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_171 2927359 : 2933847 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_172 2938162 : 2940923 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_173 2944545 : 2950642 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_174 2958919 : 2967933 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_175 2973062 : 2989117 16 Enterobacteria_phage(66.67%) integrase attL 2971247:2971261|attR 2999231:2999245
DBSCAN-SWA_176 3000470 : 3002618 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_177 3007716 : 3008697 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_178 3012057 : 3013734 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_179 3024000 : 3025461 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_180 3032028 : 3032583 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_181 3040084 : 3041029 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_182 3061043 : 3066408 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_183 3069634 : 3070914 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_184 3079103 : 3175193 104 Enterobacteria_phage(28.79%) protease,lysis,portal,holin,tRNA,transposase,integrase,tail,terminase attL 3073708:3073722|attR 3102126:3102140
DBSCAN-SWA_185 3182224 : 3185041 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_186 3189447 : 3190596 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_187 3196066 : 3201727 4 Hepacivirus(50.0%) NA NA
DBSCAN-SWA_188 3209622 : 3212376 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_189 3220120 : 3225543 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_190 3231875 : 3232574 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_191 3245276 : 3247001 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_192 3272974 : 3313615 54 Shigella_phage(63.89%) head,transposase,integrase,plate,tail attL 3268031:3268045|attR 3287009:3287023
DBSCAN-SWA_193 3317672 : 3318224 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_194 3326851 : 3328276 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_195 3335926 : 3342394 5 Mamastrovirus(33.33%) NA NA
DBSCAN-SWA_196 3345706 : 3346558 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_197 3357241 : 3364047 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_198 3369290 : 3370088 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_199 3375999 : 3376344 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_200 3380273 : 3381698 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_201 3393582 : 3394341 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_202 3403169 : 3407285 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_203 3420243 : 3421275 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_204 3427932 : 3435785 9 Indivirus(25.0%) NA NA
DBSCAN-SWA_205 3446258 : 3449024 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_206 3459988 : 3466444 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_207 3473622 : 3477541 6 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_208 3483369 : 3484536 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_209 3489213 : 3496795 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_210 3515698 : 3519004 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_211 3524579 : 3535055 5 Catovirus(33.33%) holin NA
DBSCAN-SWA_212 3551313 : 3552363 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_213 3567116 : 3568016 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_214 3572557 : 3576837 2 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_215 3582247 : 3584208 2 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_216 3587385 : 3588495 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_217 3598234 : 3599508 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_218 3602860 : 3604018 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_219 3611433 : 3612549 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_220 3616838 : 3626810 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_221 3633762 : 3642743 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_222 3666575 : 3671622 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_223 3674750 : 3675446 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_224 3678769 : 3682316 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_225 3691151 : 3694301 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_226 3701309 : 3709871 8 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_227 3718115 : 3721075 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_228 3725614 : 3798337 81 Enterobacteria_phage(50.88%) capsid,head,protease,lysis,portal,tRNA,transposase,integrase,tail,terminase attL 3732426:3732485|attR 3806615:3807382
DBSCAN-SWA_229 3808632 : 3811776 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_230 3822702 : 3828745 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_231 3843887 : 3845108 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_232 3848175 : 3850290 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_233 3865715 : 3866363 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_234 3871178 : 3873617 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_235 3880627 : 3883210 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_236 3890148 : 3893681 3 Bathycoccus_sp._RCC1105_virus(50.0%) NA NA
DBSCAN-SWA_237 3901577 : 3902657 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_238 3906753 : 3908418 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_239 3913044 : 3916858 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_240 3921317 : 3922082 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_241 3929513 : 3942234 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_242 3947513 : 3950416 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_243 3953794 : 3954586 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_244 3990724 : 3994244 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_245 3998600 : 4005174 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_246 4015528 : 4016818 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_247 4023299 : 4024208 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_248 4034805 : 4050896 14 Anomala_cuprea_entomopoxvirus(14.29%) transposase NA
DBSCAN-SWA_249 4054436 : 4059661 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_250 4064658 : 4066251 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_251 4070143 : 4074274 3 Citrobacter_phage(50.0%) NA NA
DBSCAN-SWA_252 4077592 : 4079464 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_253 4090799 : 4092002 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_254 4100568 : 4109718 11 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_255 4113055 : 4115793 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_256 4119380 : 4121099 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_257 4130396 : 4154233 16 uncultured_Mediterranean_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_258 4160543 : 4163758 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_259 4167856 : 4168945 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_260 4174031 : 4178572 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_261 4193277 : 4204410 8 Rhodobacter_phage(20.0%) tRNA NA
DBSCAN-SWA_262 4220331 : 4222239 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_263 4234838 : 4236893 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_264 4241126 : 4326724 80 Escherichia_phage(42.86%) protease,lysis,portal,holin,integrase,tail,terminase attL 4274145:4274204|attR 4305402:4306171
DBSCAN-SWA_265 4341501 : 4342425 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_266 4349244 : 4351806 2 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_267 4357042 : 4357876 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_268 4362010 : 4362544 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_269 4371852 : 4372773 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_270 4377435 : 4377681 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_271 4393527 : 4394469 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_272 4406827 : 4408009 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_273 4411281 : 4412924 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_274 4425238 : 4425496 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_275 4432785 : 4436508 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_276 4439784 : 4441762 2 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_277 4446882 : 4448253 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_278 4451389 : 4458681 6 Phage_21(25.0%) transposase NA
DBSCAN-SWA_279 4467214 : 4468902 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_280 4495643 : 4498395 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_281 4501531 : 4505539 5 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_282 4508640 : 4508871 1 Spodoptera_litura_granulovirus(100.0%) NA NA
DBSCAN-SWA_283 4520002 : 4530013 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_284 4539860 : 4541875 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_285 4546568 : 4547138 1 Aeromonas_phage(100.0%) NA NA
DBSCAN-SWA_286 4552313 : 4639010 89 Escherichia_phage(33.87%) capsid,head,protease,holin,transposase,integrase,tail,terminase attL 4556117:4556133|attR 4613914:4613930
DBSCAN-SWA_287 4643934 : 4644525 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_288 4652340 : 4657998 5 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_289 4670913 : 4672179 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_290 4685926 : 4687009 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_291 4696071 : 4697345 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_292 4706526 : 4707042 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_293 4713365 : 4720635 6 Bacillus_phage(20.0%) tRNA NA
DBSCAN-SWA_294 4725595 : 4726585 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_295 4757871 : 4761774 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_296 4765713 : 4766662 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_297 4778467 : 4788641 10 Escherichia_phage(20.0%) transposase NA
DBSCAN-SWA_298 4792021 : 4792849 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_299 4797114 : 4799217 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_300 4804126 : 4806235 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_301 4816915 : 4818460 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_302 4825345 : 4825636 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_303 4831648 : 4833090 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_304 4836364 : 4838270 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_305 4845001 : 4846384 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_306 4851663 : 4858599 3 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_307 4873821 : 4972961 106 Enterobacteria_phage(31.15%) capsid,head,lysis,portal,transposase,integrase,tail,terminase attL 4958729:4958746|attR 4961281:4961298
DBSCAN-SWA_308 4977842 : 4982407 4 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_309 5000168 : 5001470 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_310 5011365 : 5013177 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_311 5033061 : 5034336 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_312 5041247 : 5042746 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_313 5052327 : 5061119 9 Streptomyces_phage(20.0%) NA NA
DBSCAN-SWA_314 5068221 : 5068890 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_315 5077180 : 5078401 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_316 5081895 : 5082264 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_317 5100855 : 5120449 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_318 5131748 : 5134010 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_319 5140137 : 5140965 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_320 5148441 : 5149662 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_321 5156426 : 5157080 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_322 5162681 : 5164643 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_323 5169569 : 5170211 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_324 5173454 : 5174309 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_325 5177627 : 5182204 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_326 5188154 : 5190333 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_327 5198706 : 5207590 8 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_328 5211452 : 5213009 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_329 5218649 : 5218859 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_330 5224190 : 5226239 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_331 5233735 : 5238205 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_332 5246261 : 5247737 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_333 5254082 : 5258797 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_334 5262815 : 5264866 3 Escherichia_coli_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage