Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027315 Escherichia coli strain 2014C-3550 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP027313 Escherichia coli strain 2014C-3550 chromosome, complete genome 8 crisprs csa3,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DinG,c2c9_V-U4,DEDDh,PrimPol 0 13 15 0
NZ_CP027316 Escherichia coli strain 2014C-3550 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP027314 Escherichia coli strain 2014C-3550 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP027315
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8993 : 75115 49 Stx2-converting_phage(63.16%) protease,transposase,integrase attL 14101:14160|attR 41819:44524

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP027313
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_1 444325-444442 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_2 840081-840658 Unclear I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_3 866360-866876 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_4 1428448-1428571 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_5 3116393-3116484 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_6 3535730-3535874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_7 4380176-4380308 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027313_8 4583192-4583338 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027313_5 5.1|3116419|40|NZ_CP027313|CRISPRCasFinder 3116419-3116458 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP027313_7 7.1|4380193|42|NZ_CP027313|PILER-CR 4380193-4380234 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP027313_4 4.1|1428491|38|NZ_CP027313|CRISPRCasFinder 1428491-1428528 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP027313_7 7.2|4380252|40|NZ_CP027313|PILER-CR 4380252-4380291 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
NZ_CP027313_3 3.8|866816|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866816-866847 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP027313_2 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT 840598-840629 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
NZ_CP027313_2 2.8|840537|32|NZ_CP027313|CRISPRCasFinder,CRT 840537-840568 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
NZ_CP027313_2 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT 840598-840629 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP027313_3 3.4|866572|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866572-866603 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
NZ_CP027313_2 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT 840110-840141 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
NZ_CP027313_2 2.6|840415|32|NZ_CP027313|CRISPRCasFinder,CRT 840415-840446 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
NZ_CP027313_2 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT 840598-840629 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP027313_3 3.3|866511|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866511-866542 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
NZ_CP027313_3 3.3|866511|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866511-866542 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
NZ_CP027313_3 3.6|866694|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866694-866725 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
NZ_CP027313_2 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT 840598-840629 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP027313_3 3.2|866450|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866450-866481 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
NZ_CP027313_3 3.4|866572|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866572-866603 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688
NZ_CP027313_3 3.2|866450|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT 866450-866481 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 5.1|3116419|40|NZ_CP027313|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 7.1|4380193|42|NZ_CP027313|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 4.1|1428491|38|NZ_CP027313|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 7.2|4380252|40|NZ_CP027313|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95 

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

5. spacer 3.8|866816|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

6. spacer 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

7. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcacc	Protospacer
**...*********** *** *******.* .

8. spacer 2.8|840537|32|NZ_CP027313|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

9. spacer 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

10. spacer 3.4|866572|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75 

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
aattcacgatcatctttgattatccgcgaaga	Protospacer
.*  *  .****** *******.*********

11. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

12. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

13. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

14. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

15. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

16. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

17. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

18. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

19. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

20. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

21. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

22. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

23. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

24. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

25. spacer 2.1|840110|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719 

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

26. spacer 2.6|840415|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

27. spacer 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*

28. spacer 3.3|866511|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaaaaacgccgtgatattgccgat	Protospacer
 **. **** *.****************   .

29. spacer 3.3|866511|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaagaacgccgtgatgttgccggt	Protospacer
 **. **** *************.****   .

30. spacer 3.6|866694|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719 

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

31. spacer 2.9|840598|32|NZ_CP027313|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

32. spacer 3.2|866450|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
gcgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
*. **** ***************.**..   .

33. spacer 3.4|866572|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688 

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
tgggctgcatcatcattgattacctgcaactg	Protospacer
 ...*** ****************.**.*  .

34. spacer 3.2|866450|32|NZ_CP027313|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
ccgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
 . **** ***************.**..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 723228 : 731177 9 Stx2-converting_phage(42.86%) integrase,transposase attL 724120:724136|attR 733205:733221
DBSCAN-SWA_2 883230 : 890370 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 962985 : 1101399 179 Stx2-converting_phage(30.2%) capsid,lysis,tail,protease,holin,integrase,transposase,terminase,head attL 1014330:1014389|attR 1100376:1103074
DBSCAN-SWA_4 1203663 : 1290187 107 Escherichia_phage(44.12%) capsid,tRNA,lysis,tail,portal,protease,holin,terminase,head NA
DBSCAN-SWA_5 1519153 : 1614505 141 Escherichia_phage(29.25%) capsid,lysis,tail,portal,holin,integrase,transposase,terminase,plate,head attL 1508223:1508241|attR 1602201:1602219
DBSCAN-SWA_6 1759450 : 1864730 116 Escherichia_phage(33.87%) capsid,tail,portal,lysis,holin,integrase,transposase,terminase,head attL 1742845:1742860|attR 1863708:1863723
DBSCAN-SWA_7 1911004 : 2005672 104 Enterobacteria_phage(70.83%) capsid,tRNA,portal,tail,holin,integrase,transposase,terminase,plate attL 1948539:1948598|attR 1985874:1985994
DBSCAN-SWA_8 2239229 : 2249157 9 Enterobacteria_phage(62.5%) transposase NA
DBSCAN-SWA_9 2326664 : 2422220 106 Enterobacteria_phage(40.54%) capsid,tail,portal,lysis,holin,integrase,transposase,terminase,head attL 2357197:2357215|attR 2431436:2431454
DBSCAN-SWA_10 2797304 : 2914471 135 Stx2-converting_phage(22.97%) capsid,tRNA,tail,lysis,protease,holin,integrase,terminase,head attL 2834849:2834865|attR 2916008:2916024
DBSCAN-SWA_11 3083840 : 3180444 109 Escherichia_phage(34.29%) capsid,tail,lysis,holin,integrase,transposase,terminase,head attL 3153163:3153179|attR 3185743:3185759
DBSCAN-SWA_12 3483209 : 3534246 72 Enterobacteria_phage(47.69%) tail,portal,lysis,holin,integrase,transposase,terminase,head attL 3531413:3531428|attR 3538484:3538499
DBSCAN-SWA_13 3762766 : 3812470 66 Enterobacteria_phage(58.93%) capsid,tail,protease,portal,lysis,integrase,transposase,terminase,head attL 3762298:3762344|attR 3812484:3812530
DBSCAN-SWA_14 4579722 : 4672741 110 Shigella_phage(33.33%) tRNA,tail,protease,integrase,transposase,plate,head attL 4659396:4659411|attR 4677157:4677172
DBSCAN-SWA_15 5443851 : 5508226 74 Escherichia_phage(60.47%) capsid,tRNA,portal,tail,lysis,holin,integrase,transposase,terminase,plate,head attL 5476889:5476935|attR 5508338:5508384

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP027316
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61321 : 136751 91 Enterobacteria_phage(22.22%) protease,portal,tail,lysis,holin,head,tRNA,integrase,capsid,terminase attL 54049:54062|attR 70872:70885

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage