1. spacer 5.1|3871516|40|NZ_CP027342|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 4.1|3131704|38|NZ_CP027342|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
3. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
4. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
5. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
6. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
7. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
8. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
9. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
10. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
11. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
12. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
13. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
14. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
15. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
16. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
17. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
18. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
19. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
20. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
21. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
22. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
23. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
24. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
25. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
26. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
aaaagggccgcattgacggccctgtgttatcg---- CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga Protospacer
**************..****** ** ***
27. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to MK448792 (Streptococcus phage Javan521, complete genome) position: , mismatch: 7, identity: 0.774
actatatatttcctcaacgagtaattttgaa CRISPR spacer
aatggatatttccacaacaagtaatttttta Protospacer
* *. ******** ****.********* *
28. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to NC_009018 (Streptococcus phage phi3396, complete genome) position: , mismatch: 7, identity: 0.774
actatatatttcctcaacgagtaattttgaa CRISPR spacer
aatggatatttccacaacaagtaatttttta Protospacer
* *. ******** ****.********* *
29. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 7, identity: 0.774
actatatatttcctcaacgagtaattttgaa CRISPR spacer
aatggatatttccacaacaagtaatttttta Protospacer
* *. ******** ****.********* *
30. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to MK448770 (Streptococcus phage Javan477, complete genome) position: , mismatch: 7, identity: 0.774
actatatatttcctcaacgagtaattttgaa CRISPR spacer
aatggatatttccacaacaagtaatttttta Protospacer
* *. ******** ****.********* *
31. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 7, identity: 0.774
actatatatttcctcaacgagtaattttgaa CRISPR spacer
aatggatatttccacaacaagtaatttttta Protospacer
* *. ******** ****.********* *
32. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 7, identity: 0.774
actatatatttcctcaacgagtaattttgaa CRISPR spacer
aatggatatttccacaacaagtaatttttta Protospacer
* *. ******** ****.********* *
33. spacer 3.4|1893763|31|NZ_CP027342|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 7, identity: 0.774
tttaccgccccgcagaggcgctggcagatcc CRISPR spacer
atcatcctcccgcagatgcgctggccgatcc Protospacer
*.*.* .******** ******** *****
34. spacer 2.9|1867613|32|NZ_CP027342|PILER-CR matches to NC_019341 (Pseudomonas syringae plasmid pNCPPB880-40, complete sequence) position: , mismatch: 8, identity: 0.75
aaaagggccgcattgacggccctgtgttatcg CRISPR spacer
aaaagggccgcattagcggcccttttaatttg Protospacer
**************..******* * *.*
35. spacer 2.11|1867735|32|NZ_CP027342|PILER-CR matches to AB452989 (Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds) position: , mismatch: 8, identity: 0.75
gggtggcggtggtgctgtaattcacaccggta CRISPR spacer
ggcgcgtggtggtgctgttgttcacaccggcc Protospacer
** *.*********** .**********.
36. spacer 2.17|1867607|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_019341 (Pseudomonas syringae plasmid pNCPPB880-40, complete sequence) position: , mismatch: 8, identity: 0.75
aaaagggccgcattgacggccctgtgttatcg CRISPR spacer
aaaagggccgcattagcggcccttttaatttg Protospacer
**************..******* * *.*
37. spacer 2.19|1867729|32|NZ_CP027342|CRISPRCasFinder,CRT matches to AB452989 (Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds) position: , mismatch: 8, identity: 0.75
gggtggcggtggtgctgtaattcacaccggta CRISPR spacer
ggcgcgtggtggtgctgttgttcacaccggcc Protospacer
** *.*********** .**********.
38. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to MK448792 (Streptococcus phage Javan521, complete genome) position: , mismatch: 8, identity: 0.742
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttag Protospacer
*. ******** ****.********* *
39. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to NC_009018 (Streptococcus phage phi3396, complete genome) position: , mismatch: 8, identity: 0.742
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttag Protospacer
*. ******** ****.********* *
40. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 8, identity: 0.742
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttag Protospacer
*. ******** ****.********* *
41. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to MK448770 (Streptococcus phage Javan477, complete genome) position: , mismatch: 8, identity: 0.742
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttag Protospacer
*. ******** ****.********* *
42. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 8, identity: 0.742
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttag Protospacer
*. ******** ****.********* *
43. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 8, identity: 0.742
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttag Protospacer
*. ******** ****.********* *
44. spacer 3.4|1893763|31|NZ_CP027342|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742
tttaccgccccgcagaggcgctggcagatcc CRISPR spacer
gagaccgcctcgccgaggcgctggcagcgac Protospacer
******.*** ************* *
45. spacer 2.1|1867120|32|NZ_CP027342|PILER-CR,CRISPRCasFinder,CRT matches to MN693946 (Marine virus AFVG_250M886, complete genome) position: , mismatch: 9, identity: 0.719
ctggcagcactgcgggaaatattgttgctgct CRISPR spacer
tcagcagcactgcgggaactatttttgtcgaa Protospacer
...*************** **** ***..*
46. spacer 2.1|1867120|32|NZ_CP027342|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050444 (Tolypothrix sp. PCC 7910 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ctggcagcactgcgggaaatatt-gttgctgct CRISPR spacer
ctggcagcactgctggaaacattagccagcgt- Protospacer
************* *****.*** *... .*.
47. spacer 2.4|1867303|32|NZ_CP027342|PILER-CR,CRISPRCasFinder,CRT matches to MN693437 (Marine virus AFVG_25M476, complete genome) position: , mismatch: 9, identity: 0.719
gagctgatattttgataacatcaacagttcaa CRISPR spacer
aacaatagtttttgattacatcaacagatcaa Protospacer
.* * ******* ********** ****
48. spacer 2.6|1867425|32|NZ_CP027342|PILER-CR,CRISPRCasFinder,CRT matches to NC_019911 (Yersinia phage phi80-18 complete genome) position: , mismatch: 9, identity: 0.719
cgcaacatcgccagatttgtcgtaggaaagca CRISPR spacer
cgcaacatcgccatatatgtcgttaggtactc Protospacer
************* ** ****** .*. * .
49. spacer 2.6|1867425|32|NZ_CP027342|PILER-CR,CRISPRCasFinder,CRT matches to NC_047805 (Yersinia phage fHe-Yen3-01, complete genome) position: , mismatch: 9, identity: 0.719
cgcaacatcgccagatttgtcgtaggaaagca CRISPR spacer
cgcaacatcgccatatatgtcgttaggtactc Protospacer
************* ** ****** .*. * .
50. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
51. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
52. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
53. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
54. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
55. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
56. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
57. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
58. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
59. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
60. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
61. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
62. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
63. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
64. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
65. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
66. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
67. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
68. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
69. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
70. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
71. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
72. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
73. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
74. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
75. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
76. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
77. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
78. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
79. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
80. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
81. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
82. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
83. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
84. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
85. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
86. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
87. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
88. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
89. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
90. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
91. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
92. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
93. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
94. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
95. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
96. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
97. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
98. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
99. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
100. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
101. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
102. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
103. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
104. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
105. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
106. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
107. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
108. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
109. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
110. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
111. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
112. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
113. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
114. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
115. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
116. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
117. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
118. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
119. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
120. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
121. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
122. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
123. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
124. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
125. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
126. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
127. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
128. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
129. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
130. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
131. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
132. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
133. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
134. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
135. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
136. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
137. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
138. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
139. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
140. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
141. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
142. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
143. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
144. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
145. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
146. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
147. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
148. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
149. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
150. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
151. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
152. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
153. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
154. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
155. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
156. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
157. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
158. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
159. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
160. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
161. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
162. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
163. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
164. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
165. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
166. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
167. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
168. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
169. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
170. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
171. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
172. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
173. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
174. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
175. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
176. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
177. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
178. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
179. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
180. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
181. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
182. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
183. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
184. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
185. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
186. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
187. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
188. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
189. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
190. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
191. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
192. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
193. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
194. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
195. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
196. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
197. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
198. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
199. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
200. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
201. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
202. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
203. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
204. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
205. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
206. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
207. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
208. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
209. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
210. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
211. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
212. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
213. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
214. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
215. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
216. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
217. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
218. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
219. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
220. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
221. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
222. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
223. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
224. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
225. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
226. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
227. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
228. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
229. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
230. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
231. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
232. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
233. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
234. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
235. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
236. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
237. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
238. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
239. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
240. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
241. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
242. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
243. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
244. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
245. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
246. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
247. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
248. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
249. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
250. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
251. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
252. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
253. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
254. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
255. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
256. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
257. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
258. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
259. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
260. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
261. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
262. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
263. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
264. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
265. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
266. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
267. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
268. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
269. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
270. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
271. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
272. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
273. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
274. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
275. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
276. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
277. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
278. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
279. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
280. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
281. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
282. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
283. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
284. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
285. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
286. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
287. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
288. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
289. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
290. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
291. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
292. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
293. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
294. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
295. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
296. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
297. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
298. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
299. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
300. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
301. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
302. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
303. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
304. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
305. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
306. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
307. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
308. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
309. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
310. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
311. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
312. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
313. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
314. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
315. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
316. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
317. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
318. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
319. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
320. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
321. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
322. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
323. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
324. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
325. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
326. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
327. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
328. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
329. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
330. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
331. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
332. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
333. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
334. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
335. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
336. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
337. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
338. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
339. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
340. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
341. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
342. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
343. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
344. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
345. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
346. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
347. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
348. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
349. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
350. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
351. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
352. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
353. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
354. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
355. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
356. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
357. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
358. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
359. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
360. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
361. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
362. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
363. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
364. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
365. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
366. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
367. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
368. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
369. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
370. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
371. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
372. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
373. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
374. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
375. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
376. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
377. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
378. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
379. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
380. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
381. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
382. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
383. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
384. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
385. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
386. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
387. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
388. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
389. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
390. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
391. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
392. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
393. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
394. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
395. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
396. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
397. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
398. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
399. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
400. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
401. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
402. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
403. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
404. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
405. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
406. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
407. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
408. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
409. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
410. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
411. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
412. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
413. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
414. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
415. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
416. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
417. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
418. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
419. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
420. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
421. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
422. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
423. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
424. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
425. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
426. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
427. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
428. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
429. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
430. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
431. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
432. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
433. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
434. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
435. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
436. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
437. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
438. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
439. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
440. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
441. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
442. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
443. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
444. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
445. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
446. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
447. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
448. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
449. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
450. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
451. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
452. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
453. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
454. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
455. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
456. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
457. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
458. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
459. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
460. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
461. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
462. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
463. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
464. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
465. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
466. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
467. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
468. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
469. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
470. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
471. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
472. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
473. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
474. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
475. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
476. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
477. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
478. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
479. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
480. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
481. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
482. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
483. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
484. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
485. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
486. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
487. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
488. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
489. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
490. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
491. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
492. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
493. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
494. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
495. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
496. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
497. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
498. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
499. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
500. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
501. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
502. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
503. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
504. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
505. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
506. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
507. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
508. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
509. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
510. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
511. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
512. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
513. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
514. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
515. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
516. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
517. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
518. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
519. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
520. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
521. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
522. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
523. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
524. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
525. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
526. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
527. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
528. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
529. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
530. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
531. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
532. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
533. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
534. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
535. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
536. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
537. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
538. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
539. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
540. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
541. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
542. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
543. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
544. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
545. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
546. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
547. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
548. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
549. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
550. spacer 2.13|1867857|32|NZ_CP027342|PILER-CR matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
551. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
552. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
553. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
554. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
555. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
556. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
557. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
558. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
559. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
560. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
561. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
562. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
563. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
564. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
565. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
566. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
567. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
568. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
569. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
570. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
571. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
572. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
573. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
574. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
575. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
576. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
577. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
578. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
579. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
580. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
581. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
582. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
583. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
584. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
585. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
586. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
587. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
588. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
589. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
590. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
591. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
592. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
593. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
594. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
595. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
596. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
597. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
598. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
599. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
600. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
601. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
602. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
603. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
604. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
605. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
606. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
607. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
608. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
609. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
610. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
611. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
612. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
613. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
614. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
615. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
616. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
617. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
618. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
619. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
620. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
621. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
622. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
623. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
624. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
625. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
626. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
627. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
628. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
629. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
630. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
631. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
632. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
633. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
634. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
635. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
636. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
637. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
638. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
639. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
640. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
641. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
642. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
643. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
644. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
645. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
646. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
647. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
648. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
649. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
650. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
651. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
652. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
653. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
654. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
655. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
656. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
657. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
658. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
659. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
660. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
661. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
662. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
663. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
664. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
665. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
666. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
667. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
668. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
669. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
670. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
671. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
672. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
673. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
674. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
675. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
676. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
677. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
678. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
679. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
680. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
681. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
682. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
683. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
684. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
685. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
686. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
687. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
688. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
689. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
690. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
691. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
692. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
693. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
694. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
695. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
696. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
697. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
698. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
699. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
700. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
701. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
702. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
703. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
704. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
705. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
706. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
707. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
708. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
709. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
710. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
711. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
712. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
713. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
714. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
715. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
716. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
717. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
718. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
719. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
720. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
721. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
722. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
723. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
724. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
725. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
726. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
727. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
728. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
729. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
730. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
731. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
732. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
733. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
734. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
735. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
736. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
737. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
738. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
739. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
740. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
741. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
742. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
743. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
744. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
745. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
746. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
747. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
748. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
749. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
750. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
751. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
752. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
753. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
754. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
755. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
756. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
757. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
758. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
759. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
760. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
761. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
762. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
763. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
764. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
765. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
766. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
767. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
768. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
769. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
770. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
771. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
772. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
773. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
774. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
775. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
776. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
777. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
778. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
779. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
780. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
781. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
782. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
783. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
784. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
785. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
786. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
787. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
788. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
789. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
790. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
791. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
792. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
793. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
794. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
795. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
796. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
797. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
798. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
799. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
800. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
801. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
802. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
803. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
804. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
805. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
806. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
807. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
808. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
809. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
810. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
811. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
812. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
813. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
814. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
815. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
816. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
817. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
818. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
819. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
820. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
821. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
822. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
823. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
824. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
825. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
826. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
827. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
828. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
829. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
830. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
831. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
832. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
833. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
834. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
835. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
836. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
837. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
838. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
839. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
840. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
841. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
842. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
843. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
844. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
845. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
846. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
847. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
848. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
849. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
850. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
851. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
852. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
853. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
854. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
855. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
856. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
857. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
858. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
859. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
860. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
861. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
862. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
863. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
864. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
865. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
866. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
867. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
868. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
869. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
870. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
871. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
872. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
873. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
874. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
875. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
876. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
877. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
878. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
879. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
880. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
881. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
882. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
883. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
884. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
885. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
886. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
887. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
888. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
889. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
890. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
891. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
892. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
893. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
894. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
895. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
896. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
897. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
898. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
899. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
900. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
901. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
902. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
903. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
904. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
905. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
906. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
907. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
908. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
909. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
910. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
911. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
912. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
913. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
914. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
915. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
916. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
917. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
918. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
919. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
920. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
921. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
922. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
923. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
924. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
925. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
926. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
927. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
928. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
929. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
930. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
931. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
932. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
933. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
934. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
935. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
936. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
937. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
938. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
939. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
940. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
941. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
942. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
943. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
944. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
945. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
946. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
947. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
948. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
949. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
950. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
951. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
952. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
953. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
954. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
955. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
956. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
957. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
958. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
959. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
960. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
961. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
962. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
963. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
964. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
965. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
966. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
967. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
968. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
969. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
970. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
971. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
972. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
973. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
974. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
975. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
976. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
977. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
978. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
979. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
980. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
981. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
982. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
983. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
984. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
985. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
986. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
987. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
988. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
989. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
990. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
991. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
992. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
993. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
994. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
995. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
996. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
997. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
998. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
999. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1000. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1001. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1002. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1003. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1004. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1005. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1006. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1007. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1008. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1009. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1010. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1011. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1012. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1013. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1014. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1015. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1016. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1017. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1018. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1019. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1020. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1021. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1022. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1023. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1024. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1025. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1026. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1027. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1028. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1029. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1030. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1031. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1032. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1033. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1034. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1035. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1036. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1037. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1038. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1039. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1040. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1041. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1042. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1043. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1044. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1045. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1046. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1047. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1048. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1049. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1050. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1051. spacer 2.21|1867851|32|NZ_CP027342|CRISPRCasFinder,CRT matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719
acggggacgaatcacagcagcgttatcgtgat CRISPR spacer
agcaacttgagtcacagcagcgttatcttgat Protospacer
* .. .**.**************** ****
1052. spacer 3.1|1893701|31|NZ_CP027342|PILER-CR matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 9, identity: 0.71
actatatatttcctcaacgagtaattttgaa CRISPR spacer
gatggatatttccacaacaagtaattttttg Protospacer
. *. ******** ****.********* .
1053. spacer 3.2|1893762|31|NZ_CP027342|PILER-CR matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71
gtttaccgccccgcagaggcgctggcagatc CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcga Protospacer
******.*** *************
1054. spacer 3.3|1893702|31|NZ_CP027342|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 9, identity: 0.71
ctatatatttcctcaacgagtaattttgaat CRISPR spacer
atggatatttccacaacaagtaattttttgg Protospacer
*. ******** ****.********* .
1055. spacer 2.1|1867120|32|NZ_CP027342|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011146 (Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence) position: , mismatch: 11, identity: 0.656
ctggcagcactgcgggaaatattgttgctgct CRISPR spacer
tacccagcacggcaggaaatattgttggaaaa Protospacer
. ****** **.************* .