Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027119 Escherichia coli strain 26561 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP027120 Escherichia coli strain 26561 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP027118 Escherichia coli strain 26561 chromosome, complete genome 9 crisprs cas3,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4,RT,WYL 0 11 8 0

Results visualization

1. NZ_CP027119
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 66228 48 Macacine_betaherpesvirus(35.71%) protease,integrase,transposase attL 48035:48094|attR 57520:58288
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP027118
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_1 990902-991295 Unclear I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_2 1016846-1017547 TypeI-E I-E
11 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_3 1555419-1555536 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_4 2148056-2148179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_5 2786022-2786113 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_6 2788401-2788529 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_7 3065952-3066096 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_8 3315179-3315275 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027118_9 3453358-3453502 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027118_5 5.1|2786048|40|NZ_CP027118|CRISPRCasFinder 2786048-2786087 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP027118_4 4.1|2148099|38|NZ_CP027118|CRISPRCasFinder 2148099-2148136 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP027118_2 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017121-1017152 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
NZ_CP027118_2 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017121-1017152 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
NZ_CP027118_2 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017182-1017213 32 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 24790-24821 7 0.781
NZ_CP027118_2 2.7|1017243|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017243-1017274 32 MF351863 Synechococcus phage Bellamy, complete genome 123998-124029 7 0.781
NZ_CP027118_1 1.3|991052|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 991052-991084 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 375744-375776 8 0.758
NZ_CP027118_2 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017121-1017152 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
NZ_CP027118_2 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017121-1017152 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
NZ_CP027118_2 2.11|1017487|32|NZ_CP027118|CRISPRCasFinder,CRT 1017487-1017518 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 26182-26214 9 0.727
NZ_CP027118_2 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017182-1017213 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1143591-1143622 9 0.719
NZ_CP027118_2 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017182-1017213 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 891493-891524 9 0.719
NZ_CP027118_2 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017182-1017213 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1143594-1143625 9 0.719
NZ_CP027118_2 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017182-1017213 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 315030-315061 9 0.719
NZ_CP027118_2 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017182-1017213 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1123532-1123563 9 0.719
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 CP046443 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence 31933-31965 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 103013-103045 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 110510-110542 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_CP034079 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence 48454-48486 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_CP034080 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence 39480-39512 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 31117-31149 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 30966-30998 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_CP026560 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence 19118-19150 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_LT963406 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence 54820-54852 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 LT985193 Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2 32077-32109 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_LT963393 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence 50597-50629 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_LT985210 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence 105842-105874 10 0.697
NZ_CP027118_2 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1016937-1016969 33 NZ_LT985211 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence 84272-84304 10 0.697
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 156123-156154 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 21888-21919 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 28766-28797 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 JX469826 Uncultured bacterium plasmid pB12, complete sequence 11283-11314 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 11289-11320 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 11287-11318 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 11272-11303 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 67078-67109 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 4235-4266 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 11288-11319 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 11288-11319 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 11288-11319 10 0.688
NZ_CP027118_2 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017060-1017091 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 11350-11381 10 0.688
NZ_CP027118_2 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 1017121-1017152 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
NZ_CP027118_9 9.1|3453401|59|NZ_CP027118|CRISPRCasFinder 3453401-3453459 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP027118_1 1.2|990991|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 990991-991023 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP027118_1 1.2|990991|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT 990991-991023 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
NZ_CP027118_9 9.1|3453401|59|NZ_CP027118|CRISPRCasFinder 3453401-3453459 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814

1. spacer 5.1|2786048|40|NZ_CP027118|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.1|2148099|38|NZ_CP027118|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

-ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
tccgctcg-gcaggctgcaacgcaagccgccca	Protospacer
 *.*** * ** ******** ************

4. spacer 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

-ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
tccgctcg-gcaggctgcaacgcaagccgcccc	Protospacer
 *.*** * ** ******** *********** 

5. spacer 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 7, identity: 0.781

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
cccatcagcgcgttttttggcggtgtgatgga	Protospacer
****.************** *** *. **.* 

6. spacer 2.7|1017243|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.781

ttgaactcaccacgattgttaatatggacgat	CRISPR spacer
aaggtatcaccacgattgttgatatgggcgat	Protospacer
  *.  **************.******.****

7. spacer 1.3|991052|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

8. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.758

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ctgatcgcgcattacctgcgcgtcgccgacgcg	Protospacer
* .*********  ************** *   

9. spacer 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
gagcatcggctggctgcaaggcaagctgcccc	Protospacer
  **   .******************.**** 

10. spacer 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
gcggaagcgctggctgcacggcaagcggccca	Protospacer
 .*  .* ********** ******* *****

11. spacer 2.11|1017487|32|NZ_CP027118|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgacggtgagatttcacgcctgacgctg	CRISPR spacer
tcaacgacggtaagatgtcacgcctaaagaat	Protospacer
 **********.**** ********.* *   

12. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 9, identity: 0.727

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ctcgacccgcataccttgcgtgtcgccgcctcg	Protospacer
*  . * ********.****.**********  

13. spacer 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

14. spacer 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

15. spacer 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

16. spacer 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

17. spacer 2.6|1017182|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

18. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to CP046443 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

19. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

20. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

21. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034079 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

22. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034080 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

23. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

24. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

25. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026560 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

26. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963406 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

27. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to LT985193 (Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

28. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963393 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

29. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985210 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

30. spacer 2.2|1016937|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985211 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

cgaatcgcgcataccctgcgcgtcgccgcctgc	CRISPR spacer
ttcgctgcgcatctcctgcgcgtcgccgccggt	Protospacer
.  ...****** .**************** *.

31. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
acgtcaccccggaagcgattgccagcacacgc	Protospacer
.  ********.*** **********  .* .

32. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

33. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

34. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

35. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

36. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

37. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

38. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

39. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

40. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

41. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

42. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

43. spacer 2.4|1017060|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

44. spacer 2.5|1017121|32|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
ccctgagagctggctgccacgcaagccgctgg	Protospacer
*. . .*********** * *********. .

45. spacer 9.1|3453401|59|NZ_CP027118|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

-cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc	CRISPR spacer
tcagtgcac-gatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctc	Protospacer
 *.* ****  **.**************************** ************   .*

46. spacer 1.2|990991|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

47. spacer 1.2|990991|33|NZ_CP027118|PILER-CR,CRISPRCasFinder,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

48. spacer 9.1|3453401|59|NZ_CP027118|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc-	CRISPR spacer
ggtacggctttttgccggatgcggcgtaaacgccttatccggcctacggtt-tggtgcga	Protospacer
 * *  .*** ****************.*********************** ***..*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1024973 : 1038156 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1684100 : 1693541 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 2235751 : 2260899 36 Enterobacteria_phage(40.0%) lysis,integrase attL 2231041:2231056|attR 2254971:2254986
DBSCAN-SWA_4 2923754 : 2982193 52 Salmonella_phage(21.74%) portal,tRNA,terminase,tail,protease NA
DBSCAN-SWA_5 3530307 : 3594921 56 Shigella_phage(44.44%) holin,tail,transposase,integrase attL 3547257:3547273|attR 3581736:3581752
DBSCAN-SWA_6 3885463 : 3909765 29 Escherichia_phage(39.29%) lysis,tail,integrase attL 3894190:3894205|attR 3916308:3916323
DBSCAN-SWA_7 3988680 : 4060404 59 Vibrio_phage(17.65%) protease,tRNA,transposase,integrase attL 4015398:4015414|attR 4035496:4035512
DBSCAN-SWA_8 4487631 : 4496314 12 Escherichia_phage(36.36%) integrase attL 4478424:4478438|attR 4496396:4496410
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage