Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028584 Pseudomonas aeruginosa strain WCHPA075019 chromosome, complete genome 1 crisprs csa3,RT,WYL,DEDDh,cas3,DinG 0 1 4 0

Results visualization

1. NZ_CP028584
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028584_1 2091029-2091130 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028584_1 1.1|2091054|52|NZ_CP028584|CRISPRCasFinder 2091054-2091105 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 1.1|2091054|52|NZ_CP028584|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 631904 : 714369 80 Pseudomonas_phage(39.53%) tail,tRNA,plate,transposase,integrase attL 696985:696999|attR 717357:717371
DBSCAN-SWA_2 1668998 : 1678026 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 2913607 : 2920501 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_4 5199168 : 5206660 12 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage