Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028999 Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 0 crisprs csa3,RT 0 0 0 0
NZ_CP028997 Klebsiella pneumoniae strain AR_0079 plasmid unnamed4, complete sequence 0 crisprs PD-DExK,DEDDh 0 0 2 0
NZ_CP028998 Klebsiella pneumoniae strain AR_0079 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028994 Klebsiella pneumoniae strain AR_0079 chromosome, complete genome 3 crisprs DEDDh,cas3,WYL,RT,DinG,csa3 0 1 397 0

Results visualization

1. NZ_CP029000
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 32778 : 44870 12 Enterobacteria_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028997
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 59389 58 Salmonella_phage(94.12%) tail,portal,terminase NA
DBSCAN-SWA_2 62502 : 109864 49 Salmonella_phage(83.72%) integrase attL 86221:86235|attR 107955:107969
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP028999
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15344 : 24420 6 Salmonella_phage(66.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP028996
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2061 : 31046 30 Enterobacteria_phage(33.33%) integrase,transposase attL 11279:11338|attR 31675:32874
DBSCAN-SWA_2 98535 : 133129 32 Salmonella_phage(41.67%) integrase,transposase attL 94181:94201|attR 142915:142935
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP028994
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028994_1 1354632-1354717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028994_2 1838601-1838696 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028994_3 2152408-2152485 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028994_2 2.1|1838631|36|NZ_CP028994|CRISPRCasFinder 1838631-1838666 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP028994_2 2.1|1838631|36|NZ_CP028994|CRISPRCasFinder 1838631-1838666 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP028994_2 2.1|1838631|36|NZ_CP028994|CRISPRCasFinder 1838631-1838666 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|1838631|36|NZ_CP028994|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 2.1|1838631|36|NZ_CP028994|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 2.1|1838631|36|NZ_CP028994|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 46968 50 uncultured_Caudovirales_phage(78.57%) tail,portal,head,integrase,terminase,capsid,protease,tRNA attL 31147:31164|attR 47142:47159
DBSCAN-SWA_2 63293 : 64765 2 Synechococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_3 84668 : 88037 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_4 95882 : 105526 9 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_5 116927 : 117755 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_6 132578 : 136350 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_7 149176 : 151567 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_8 154912 : 155671 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_9 159528 : 161976 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_10 179721 : 181529 2 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_11 184955 : 187188 4 Anomala_cuprea_entomopoxvirus(66.67%) NA NA
DBSCAN-SWA_12 194509 : 200310 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_13 203394 : 207531 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_14 213831 : 217938 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_15 224040 : 224832 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_16 233373 : 235416 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_17 279145 : 285118 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_18 289441 : 290805 1 Bacillus_phage(100.0%) transposase NA
DBSCAN-SWA_19 297624 : 300364 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_20 305523 : 306495 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_21 309898 : 311829 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_22 316205 : 317201 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_23 322669 : 324211 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_24 332184 : 334026 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_25 349863 : 359013 9 Rhizobium_phage(20.0%) NA NA
DBSCAN-SWA_26 371781 : 376523 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_27 379982 : 380900 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_28 385942 : 394232 7 Acanthamoeba_polyphaga_mimivirus(25.0%) NA NA
DBSCAN-SWA_29 405213 : 406065 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_30 409199 : 410591 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_31 423850 : 424900 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_32 442116 : 443280 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_33 461715 : 462828 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_34 475005 : 480444 6 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_35 491453 : 493373 3 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_36 496808 : 497957 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_37 503724 : 511254 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_38 518746 : 520084 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_39 525860 : 533420 6 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_40 545770 : 546763 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_41 549928 : 555807 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_42 570101 : 572894 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_43 576782 : 579250 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_44 586072 : 586990 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_45 609961 : 611473 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_46 619811 : 623314 4 Bacillus_thuringiensis_phage(33.33%) NA NA
DBSCAN-SWA_47 627816 : 629151 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_48 640215 : 641772 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_49 646543 : 647206 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_50 661836 : 663675 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_51 673738 : 675385 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_52 683488 : 685510 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_53 690001 : 691938 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_54 695988 : 702130 6 Catovirus(20.0%) NA NA
DBSCAN-SWA_55 718497 : 722342 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_56 726177 : 729639 3 Catovirus(50.0%) transposase NA
DBSCAN-SWA_57 741640 : 744984 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_58 753702 : 754317 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 764250 : 767371 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_60 771598 : 784042 6 Chrysochromulina_ericina_virus(33.33%) NA NA
DBSCAN-SWA_61 792467 : 794231 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_62 799652 : 801242 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_63 814785 : 818469 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_64 825037 : 825841 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_65 842350 : 843460 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_66 850526 : 851135 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_67 857130 : 859657 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_68 862838 : 868145 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_69 880124 : 881156 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_70 888685 : 890035 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_71 902318 : 909103 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_72 915044 : 916565 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_73 921945 : 923492 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_74 928852 : 930355 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_75 934719 : 939806 6 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_76 959876 : 965522 5 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_77 976701 : 981895 6 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_78 989249 : 989795 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_79 994637 : 997863 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_80 1003793 : 1008137 3 Pithovirus(50.0%) NA NA
DBSCAN-SWA_81 1027734 : 1028559 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_82 1045058 : 1051637 6 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_83 1067770 : 1070902 3 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_84 1078659 : 1084717 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_85 1094810 : 1103860 6 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_86 1119751 : 1124577 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_87 1127659 : 1128922 1 Stenotrophomonas_phage(100.0%) integrase attL 1126481:1126494|attR 1133588:1133601
DBSCAN-SWA_88 1132297 : 1138122 7 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_89 1158932 : 1163890 4 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_90 1167128 : 1169235 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_91 1178991 : 1181736 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_92 1185652 : 1187137 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_93 1202724 : 1203651 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_94 1235752 : 1236775 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_95 1243779 : 1246947 3 Paramecium_bursaria_Chlorella_virus(50.0%) transposase NA
DBSCAN-SWA_96 1250107 : 1251387 2 Shigella_phage(50.0%) NA NA
DBSCAN-SWA_97 1264610 : 1267331 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_98 1272066 : 1273389 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_99 1279720 : 1284880 3 Enterococcus_phage(33.33%) NA NA
DBSCAN-SWA_100 1302037 : 1302991 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_101 1307362 : 1317315 7 Chrysochromulina_ericina_virus(25.0%) tRNA NA
DBSCAN-SWA_102 1336112 : 1337261 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_103 1343602 : 1345186 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_104 1357644 : 1363096 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_105 1369392 : 1370094 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_106 1378793 : 1379549 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_107 1390948 : 1392673 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_108 1418865 : 1419909 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_109 1424176 : 1424740 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_110 1436080 : 1437505 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_111 1447154 : 1457032 9 Shigella_phage(25.0%) transposase NA
DBSCAN-SWA_112 1462436 : 1469207 6 unidentified_phage(50.0%) tRNA NA
DBSCAN-SWA_113 1491342 : 1492140 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_114 1498106 : 1498451 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_115 1502406 : 1503840 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_116 1515418 : 1516177 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_117 1525008 : 1529108 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_118 1542092 : 1543124 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_119 1549635 : 1550439 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_120 1554504 : 1558714 5 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_121 1564222 : 1564804 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_122 1582053 : 1583337 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_123 1590870 : 1591866 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_124 1596513 : 1597911 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_125 1606367 : 1619363 14 Enterobacteria_phage(72.73%) integrase attL 1594501:1594515|attR 1617558:1617572
DBSCAN-SWA_126 1626207 : 1627050 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_127 1636123 : 1639844 5 Anomala_cuprea_entomopoxvirus(66.67%) NA NA
DBSCAN-SWA_128 1650847 : 1651615 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_129 1672098 : 1680618 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_130 1697423 : 1701762 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_131 1705360 : 1710020 6 Indivirus(33.33%) NA NA
DBSCAN-SWA_132 1722805 : 1724503 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_133 1738809 : 1743978 4 Agrobacterium_phage(25.0%) protease NA
DBSCAN-SWA_134 1747208 : 1747910 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_135 1752337 : 1755881 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_136 1766804 : 1767914 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_137 1777088 : 1786479 10 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_138 1792000 : 1799811 9 Sodalis_phage(25.0%) transposase NA
DBSCAN-SWA_139 1809956 : 1815162 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_140 1818344 : 1819031 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_141 1827575 : 1872850 63 Escherichia_phage(26.42%) head,lysis,integrase,tRNA attL 1830458:1830504|attR 1879592:1879638
DBSCAN-SWA_142 1877317 : 1879436 3 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_143 1890909 : 1891830 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_144 1898053 : 1901378 2 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_145 1909619 : 1915420 5 Amsacta_moorei_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_146 1922042 : 1922840 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_147 1930529 : 1932057 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_148 1936614 : 1942528 4 Catovirus(50.0%) holin NA
DBSCAN-SWA_149 1949231 : 1950776 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_150 1962168 : 1966909 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_151 1979251 : 1983672 5 Burkholderia_phage(50.0%) NA NA
DBSCAN-SWA_152 2000783 : 2014498 12 Cedratvirus(20.0%) NA NA
DBSCAN-SWA_153 2017633 : 2019704 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_154 2023794 : 2024455 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_155 2029333 : 2031820 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_156 2038864 : 2046830 5 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_157 2052834 : 2053881 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_158 2057921 : 2059586 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_159 2064339 : 2068141 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_160 2072829 : 2073603 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_161 2080429 : 2087859 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_162 2093668 : 2094460 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_163 2118783 : 2122294 4 Vibriophage(33.33%) NA NA
DBSCAN-SWA_164 2126655 : 2133178 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_165 2138024 : 2138759 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_166 2148851 : 2154474 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_167 2158277 : 2159000 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_168 2165497 : 2166403 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_169 2176570 : 2178310 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_170 2183515 : 2191480 8 Micromonas_pusilla_virus(20.0%) NA NA
DBSCAN-SWA_171 2195554 : 2200706 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_172 2204707 : 2206084 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_173 2209093 : 2210686 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_174 2218665 : 2221098 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_175 2225341 : 2227201 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_176 2238906 : 2240906 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_177 2245981 : 2341863 92 Salmonella_phage(45.45%) tail,transposase,portal,plate,head,integrase,terminase,capsid,protease,tRNA,lysis attL 2245889:2245907|attR 2276188:2276206
DBSCAN-SWA_178 2345913 : 2347002 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_179 2351175 : 2355718 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_180 2374751 : 2376152 1 Bandra_megavirus(100.0%) tRNA NA
DBSCAN-SWA_181 2382214 : 2387337 3 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_182 2396103 : 2398011 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_183 2410703 : 2412758 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_184 2417700 : 2418360 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_185 2442498 : 2446017 4 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_186 2462581 : 2463640 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_187 2471741 : 2472269 1 Infectious_spleen_and_kidney_necrosis_virus(100.0%) NA NA
DBSCAN-SWA_188 2480620 : 2481541 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_189 2484782 : 2485034 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_190 2504189 : 2505371 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_191 2508650 : 2509292 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_192 2529016 : 2535082 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_193 2539514 : 2540651 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_194 2547216 : 2548587 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_195 2551815 : 2553066 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_196 2567676 : 2569461 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_197 2572750 : 2576336 7 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_198 2583264 : 2594698 12 Klebsiella_phage(14.29%) NA NA
DBSCAN-SWA_199 2597972 : 2598827 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_200 2602511 : 2603765 1 Artogeia_rapae_granulovirus(100.0%) NA NA
DBSCAN-SWA_201 2609457 : 2613516 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_202 2617390 : 2623404 4 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_203 2628621 : 2629254 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_204 2635311 : 2636532 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_205 2643215 : 2644043 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_206 2650307 : 2656041 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_207 2663335 : 2664013 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_208 2676257 : 2679215 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_209 2686334 : 2691700 5 Chrysochromulina_ericina_virus(50.0%) protease NA
DBSCAN-SWA_210 2696540 : 2697143 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_211 2702733 : 2704668 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_212 2709298 : 2711102 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_213 2741779 : 2783173 61 uncultured_Caudovirales_phage(33.33%) integrase,terminase attL 2742788:2742802|attR 2751728:2751742
DBSCAN-SWA_214 2787849 : 2790167 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_215 2797593 : 2802619 2 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_216 2831545 : 2832559 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_217 2840166 : 2847313 7 Escherichia_phage(40.0%) tRNA NA
DBSCAN-SWA_218 2852431 : 2853421 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_219 2879601 : 2884239 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_220 2892925 : 2894131 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_221 2906305 : 2909833 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_222 2922653 : 2923955 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_223 2935198 : 2935714 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_224 2955059 : 2957837 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_225 2967280 : 2968240 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_226 2985364 : 2996423 12 Escherichia_phage(57.14%) NA NA
DBSCAN-SWA_227 3001561 : 3002236 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_228 3011379 : 3027274 15 Escherichia_phage(70.0%) NA NA
DBSCAN-SWA_229 3031425 : 3032931 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_230 3036177 : 3036552 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_231 3048500 : 3049262 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_232 3054709 : 3056083 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_233 3069117 : 3069909 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_234 3080402 : 3081782 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_235 3107561 : 3108737 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 3116099 : 3117656 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_237 3124936 : 3125710 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_238 3143562 : 3144081 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_239 3150606 : 3151869 1 Salmonella_phage(100.0%) transposase NA
DBSCAN-SWA_240 3160045 : 3160828 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_241 3175501 : 3176554 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_242 3191923 : 3192661 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_243 3220415 : 3221672 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_244 3227618 : 3231736 4 Pithovirus(50.0%) NA NA
DBSCAN-SWA_245 3235716 : 3237797 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_246 3254319 : 3255000 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_247 3261162 : 3263775 1 Rathayibacter_phage(100.0%) NA NA
DBSCAN-SWA_248 3273802 : 3274207 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_249 3279014 : 3281351 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_250 3287839 : 3292582 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_251 3296170 : 3297787 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_252 3309058 : 3309832 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_253 3316311 : 3317811 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_254 3323918 : 3325463 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_255 3331105 : 3331807 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_256 3341246 : 3342026 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_257 3347964 : 3348516 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_258 3353096 : 3355187 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_259 3370875 : 3371889 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_260 3378797 : 3380759 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_261 3391191 : 3393832 2 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_262 3400657 : 3402709 3 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_263 3408260 : 3409631 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_264 3420886 : 3422161 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_265 3425497 : 3426859 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_266 3430665 : 3432153 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_267 3436340 : 3437213 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_268 3440484 : 3451526 11 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_269 3457000 : 3457771 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_270 3462955 : 3464904 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_271 3482213 : 3483044 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_272 3500375 : 3506020 3 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_273 3518809 : 3519433 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_274 3524290 : 3525361 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_275 3544886 : 3549287 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_276 3559937 : 3561901 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_277 3569338 : 3570088 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_278 3580008 : 3581229 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_279 3597720 : 3598482 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_280 3608461 : 3616428 7 Hokovirus(25.0%) NA NA
DBSCAN-SWA_281 3623496 : 3630665 8 Geobacillus_virus(25.0%) tRNA NA
DBSCAN-SWA_282 3640340 : 3643238 3 Lactobacillus_phage(33.33%) NA NA
DBSCAN-SWA_283 3651497 : 3657767 7 Citrobacter_phage(25.0%) NA NA
DBSCAN-SWA_284 3661780 : 3663316 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_285 3679809 : 3680598 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_286 3686110 : 3691824 7 Mythimna_unipuncta_granulovirus(33.33%) NA NA
DBSCAN-SWA_287 3695036 : 3760770 59 Microcystis_phage(25.0%) transposase,protease,plate,tRNA NA
DBSCAN-SWA_288 3768504 : 3769116 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_289 3784740 : 3792109 7 Staphylococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_290 3796011 : 3797571 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_291 3805011 : 3805221 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_292 3810458 : 3812507 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_293 3820014 : 3820668 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_294 3824392 : 3825361 2 Pectobacterium_phage(50.0%) NA NA
DBSCAN-SWA_295 3832785 : 3834261 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_296 3838186 : 3854733 18 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_297 3861670 : 3863185 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_298 3879792 : 3880545 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_299 3887147 : 3895591 8 Burkholderia_phage(40.0%) NA NA
DBSCAN-SWA_300 3902441 : 3907340 3 Stenotrophomonas_phage(50.0%) integrase attL 3894254:3894270|attR 3912702:3912718
DBSCAN-SWA_301 3928734 : 3928953 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_302 3941321 : 3945751 2 Pseudomonas_phage(50.0%) integrase attL 3930188:3930201|attR 3943569:3943582
DBSCAN-SWA_303 3954701 : 3956660 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_304 3964711 : 3966094 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_305 3974210 : 3998866 8 Bacillus_phage(40.0%) integrase attL 3963816:3963829|attR 3981109:3981122
DBSCAN-SWA_306 4006432 : 4006618 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_307 4023351 : 4024299 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_308 4036046 : 4036883 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_309 4052404 : 4057499 3 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_310 4062001 : 4062901 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_311 4069148 : 4092771 20 Escherichia_phage(23.08%) transposase NA
DBSCAN-SWA_312 4098976 : 4103092 4 Catovirus(66.67%) NA NA
DBSCAN-SWA_313 4112027 : 4118995 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_314 4136115 : 4143020 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_315 4170038 : 4177091 7 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_316 4183625 : 4184180 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_317 4200321 : 4201842 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_318 4205606 : 4209513 3 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_319 4213913 : 4214768 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_320 4220477 : 4228450 8 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_321 4234205 : 4240292 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_322 4244528 : 4245536 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_323 4251901 : 4253062 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_324 4256982 : 4258047 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_325 4264518 : 4276649 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_326 4284494 : 4285700 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_327 4288816 : 4289770 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_328 4317796 : 4318396 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_329 4330798 : 4331572 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_330 4335863 : 4337381 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_331 4343823 : 4344960 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_332 4353442 : 4354528 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_333 4363643 : 4453819 125 Salmonella_phage(36.63%) lysis,holin,integrase,terminase attL 4358230:4358246|attR 4415679:4415695
DBSCAN-SWA_334 4457089 : 4459536 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_335 4474026 : 4483953 9 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_336 4487561 : 4489686 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_337 4493039 : 4496616 5 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_338 4528507 : 4606113 78 Salmonella_phage(32.69%) transposase,tail,integrase,terminase,protease,tRNA,holin attL 4534149:4534166|attR 4603552:4603569
DBSCAN-SWA_339 4616433 : 4616865 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_340 4627377 : 4633698 8 Mycoplasma_phage(20.0%) NA NA
DBSCAN-SWA_341 4648945 : 4671013 19 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_342 4675913 : 4787247 129 Salmonella_phage(50.0%) tail,portal,plate,head,integrase,terminase,coat,capsid,tRNA,lysis,holin attL 4752341:4752387|attR 4788908:4788954
DBSCAN-SWA_343 4802612 : 4804133 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_344 4826291 : 4827194 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_345 4832375 : 4837674 5 Lactobacillus_phage(25.0%) NA NA
DBSCAN-SWA_346 4852392 : 4860597 8 Vibrio_phage(20.0%) tRNA NA
DBSCAN-SWA_347 4866382 : 4867348 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_348 4894289 : 4895690 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_349 4906055 : 4906877 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_350 4918621 : 4923785 5 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_351 4927254 : 4933673 7 uncultured_Mediterranean_phage(40.0%) NA NA
DBSCAN-SWA_352 4936743 : 4938776 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_353 4947542 : 4952879 4 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_354 4956421 : 4961887 3 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_355 4969301 : 4970147 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_356 4980402 : 4981425 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_357 4987829 : 4988585 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_358 5000130 : 5002631 3 environmental_halophage(50.0%) tRNA NA
DBSCAN-SWA_359 5007576 : 5008401 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_360 5041052 : 5052732 6 Deep-sea_thermophilic_phage(25.0%) NA NA
DBSCAN-SWA_361 5058245 : 5070163 10 Cronobacter_phage(25.0%) NA NA
DBSCAN-SWA_362 5076141 : 5077152 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_363 5082866 : 5083994 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_364 5089757 : 5093228 3 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_365 5113824 : 5115504 2 Escherichia_phage(100.0%) integrase attL 5111690:5111704|attR 5121479:5121493
DBSCAN-SWA_366 5129978 : 5134110 4 uncultured_Caudovirales_phage(75.0%) NA NA
DBSCAN-SWA_367 5137188 : 5138208 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_368 5142176 : 5150078 7 Clostridium_phage(20.0%) tRNA NA
DBSCAN-SWA_369 5154774 : 5156208 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_370 5160783 : 5163657 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_371 5171600 : 5172833 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_372 5190086 : 5190881 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_373 5204636 : 5205791 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_374 5220665 : 5221748 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_375 5229294 : 5230275 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_376 5236974 : 5238510 4 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_377 5248904 : 5250272 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_378 5271827 : 5272583 1 Lactobacillus_prophage(100.0%) NA NA
DBSCAN-SWA_379 5278863 : 5280231 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_380 5285120 : 5286491 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_381 5306201 : 5316104 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_382 5319415 : 5321311 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_383 5325653 : 5332534 8 Erwinia_phage(25.0%) NA NA
DBSCAN-SWA_384 5337645 : 5338887 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_385 5348180 : 5362540 13 Moraxella_phage(20.0%) tRNA NA
DBSCAN-SWA_386 5380618 : 5381998 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_387 5386269 : 5387757 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_388 5397320 : 5398292 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_389 5415315 : 5416461 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_390 5432567 : 5442265 12 Escherichia_phage(20.0%) NA NA
DBSCAN-SWA_391 5447958 : 5449890 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_392 5455304 : 5461923 4 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_393 5466187 : 5469064 2 Pandoravirus(50.0%) protease NA
DBSCAN-SWA_394 5475662 : 5477104 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_395 5481153 : 5494085 15 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_396 5498029 : 5498962 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_397 5506407 : 5506902 1 Pseudomonas_phage(100.0%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage