Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029156 Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence 1 crisprs NA 0 1 1 0
NZ_CP029154 Clostridioides difficile strain CD161 chromosome, complete genome 20 crisprs cas14j,PD-DExK,WYL,cas3,DEDDh,DinG,csa3,cas14k,cas5,cas7,cas6,c2c9_V-U4,RT 3 35 11 1
NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_CP029156
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029156_1 3830-3928 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029156_1 1.1|3853|53|NZ_CP029156|CRISPRCasFinder 3853-3905 53 NZ_CP020425 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence 40333-40385 0 1.0
NZ_CP029156_1 1.1|3853|53|NZ_CP029156|CRISPRCasFinder 3853-3905 53 FN668942 Clostridium difficile BI1 plasmid pCDBI1, complete sequence 39066-39118 0 1.0
NZ_CP029156_1 1.1|3853|53|NZ_CP029156|CRISPRCasFinder 3853-3905 53 NZ_CP011969 Clostridioides difficile ATCC 9689 = DSM 1296 plasmid unnamed, complete sequence 35655-35707 0 1.0
NZ_CP029156_1 1.1|3853|53|NZ_CP029156|CRISPRCasFinder 3853-3905 53 NZ_CP029156 Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence 3853-3905 0 1.0
NZ_CP029156_1 1.1|3853|53|NZ_CP029156|CRISPRCasFinder 3853-3905 53 NZ_CP029153 Clostridioides difficile strain CDT4 plasmid unnamed1, complete sequence 46490-46542 0 1.0

1. spacer 1.1|3853|53|NZ_CP029156|CRISPRCasFinder matches to NZ_CP020425 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	CRISPR spacer
tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	Protospacer
*****************************************************

2. spacer 1.1|3853|53|NZ_CP029156|CRISPRCasFinder matches to FN668942 (Clostridium difficile BI1 plasmid pCDBI1, complete sequence) position: , mismatch: 0, identity: 1.0

tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	CRISPR spacer
tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	Protospacer
*****************************************************

3. spacer 1.1|3853|53|NZ_CP029156|CRISPRCasFinder matches to NZ_CP011969 (Clostridioides difficile ATCC 9689 = DSM 1296 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	CRISPR spacer
tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	Protospacer
*****************************************************

4. spacer 1.1|3853|53|NZ_CP029156|CRISPRCasFinder matches to NZ_CP029156 (Clostridioides difficile strain CD161 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	CRISPR spacer
tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	Protospacer
*****************************************************

5. spacer 1.1|3853|53|NZ_CP029156|CRISPRCasFinder matches to NZ_CP029153 (Clostridioides difficile strain CDT4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	CRISPR spacer
tcacaaatcggacattttttagacacaaaacagacataaatcggtttaaaatc	Protospacer
*****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1914 : 47997 67 Clostridioides_phage(48.98%) capsid,portal,plate,holin,tail,integrase attL 1333:1347|attR 23690:23704
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP029154
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_1 32087-32179 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_2 641941-642065 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_3 810960-811050 Orphan ?
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_4 811176-811389 Orphan ?
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_5 811575-811667 Orphan ?
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_6 1578987-1579214 Orphan I-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_7 1688407-1689093 Orphan I-A
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_8 1779875-1780169 Orphan I-A:NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_9 1782769-1782994 Orphan I-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_10 1924167-1924586 Orphan I-A
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_11 2724328-2724488 Unclear NA
2 spacers
cas3,cas5,cas7,cas6,c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_12 2814077-2814365 Orphan I-A:NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_13 3101948-3102213 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_15 3157137-3157361 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_14 3156723-3156965 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_16 3157563-3157654 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_17 3262705-3262865 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_18 3760096-3760299 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_19 3760832-3761413 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029154_20 4147950-4148084 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP029154_1 1.1|32118|31|NZ_CP029154|CRISPRCasFinder 32118-32148 31 NZ_CP029154.1 17782-17812 0 1.0
NZ_CP029154_1 1.1|32118|31|NZ_CP029154|CRISPRCasFinder 32118-32148 31 NZ_CP029154.1 1171645-1171675 0 1.0
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 NZ_CP029154.1 3030623-3030658 1 0.972
NZ_CP029154_20 20.1|4147981|73|NZ_CP029154|CRISPRCasFinder 4147981-4148053 73 NZ_CP029154.1 32118-32190 13 0.822
NZ_CP029154_20 20.1|4147981|73|NZ_CP029154|CRISPRCasFinder 4147981-4148053 73 NZ_CP029154.1 1171645-1171717 13 0.822

1. spacer 1.1|32118|31|NZ_CP029154|CRISPRCasFinder matches to position: 17782-17812, mismatch: 0, identity: 1.0

agaataaactgaacgcatgtgaagtttgttt	CRISPR spacer
agaataaactgaacgcatgtgaagtttgttt	Protospacer
*******************************

2. spacer 1.1|32118|31|NZ_CP029154|CRISPRCasFinder matches to position: 1171645-1171675, mismatch: 0, identity: 1.0

agaataaactgaacgcatgtgaagtttgttt	CRISPR spacer
agaataaactgaacgcatgtgaagtttgttt	Protospacer
*******************************

3. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to position: 3030623-3030658, mismatch: 1, identity: 0.972

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatgtcaatatcaaggatacaaaattt	Protospacer
******************.*****************

4. spacer 20.1|4147981|73|NZ_CP029154|CRISPRCasFinder matches to position: 32118-32190, mismatch: 13, identity: 0.822

ggataaatcccgttgcttaaagtgctaacgcacagcgccaacaaacaaacttcacatgcg	CRISPR spacer
ggataaatcccgttgcttaaagtgctaacgcacagcgccaacaaacaaacttcacatgcg	Protospacer
************************************************************

5. spacer 20.1|4147981|73|NZ_CP029154|CRISPRCasFinder matches to position: 1171645-1171717, mismatch: 13, identity: 0.822

ggataaatcccgttgcttaaagtgctaacgcacagcgccaacaaacaaacttcacatgcg	CRISPR spacer
ggataaatcccgttgcttaaagtgctaacgcacagcgccaacaaacaaacttcacatgcg	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029154_6 6.1|1579028|25|NZ_CP029154|PILER-CR 1579028-1579052 25 NZ_MF547664 Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence 50448-50472 0 1.0
NZ_CP029154_6 6.3|1579017|36|NZ_CP029154|CRISPRCasFinder,CRT 1579017-1579052 36 NZ_MF547664 Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence 50447-50482 0 1.0
NZ_CP029154_7 7.4|1688635|36|NZ_CP029154|CRISPRCasFinder,CRT 1688635-1688670 36 NC_011398 Clostridium phage phiCD27, complete genome 22207-22242 0 1.0
NZ_CP029154_7 7.5|1688700|37|NZ_CP029154|CRISPRCasFinder,CRT 1688700-1688736 37 HG531805 Clostridium phage CDMH1 complete genome 45157-45193 0 1.0
NZ_CP029154_9 9.2|1782864|37|NZ_CP029154|CRT 1782864-1782900 37 HG531805 Clostridium phage CDMH1 complete genome 13828-13864 0 1.0
NZ_CP029154_9 9.3|1782930|36|NZ_CP029154|CRT 1782930-1782965 36 LN681542 Clostridium phage phiMMP03, complete genome 14215-14250 0 1.0
NZ_CP029154_9 9.3|1782930|36|NZ_CP029154|CRT 1782930-1782965 36 NC_009231 Clostridium phage phiC2, complete genome 14246-14281 0 1.0
NZ_CP029154_9 9.3|1782930|36|NZ_CP029154|CRT 1782930-1782965 36 LN681541 Clostridium phage phiMMP01, complete genome 14215-14250 0 1.0
NZ_CP029154_10 10.2|1924261|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924261-1924296 36 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 3114-3149 0 1.0
NZ_CP029154_10 10.2|1924261|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924261-1924296 36 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 118851-118886 0 1.0
NZ_CP029154_10 10.2|1924261|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924261-1924296 36 LN681537 Clostridium phage phiCD211, complete genome 127713-127748 0 1.0
NZ_CP029154_12 12.7|2814301|34|NZ_CP029154|PILER-CR 2814301-2814334 34 NC_048642 Clostridium phage CDKM9, complete genome 18002-18035 0 1.0
NZ_CP029154_1 1.1|32118|31|NZ_CP029154|CRISPRCasFinder 32118-32148 31 NZ_CP033215 Clostridioides difficile strain 12038 plasmid unnamed1, complete sequence 3094-3124 1 0.968
NZ_CP029154_7 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT 1688502-1688538 37 HM568888 Clostridium phage phiCD38-2, complete genome 1916-1952 1 0.973
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 AY855346 Clostridium difficile bacteriophage phi CD119, complete genome 20150-20185 1 0.972
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 NC_007917 Clostridium phage phi CD119, complete genome 20150-20185 1 0.972
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 NC_028996 Clostridium phage phiCDHM19, complete genome 20404-20439 1 0.972
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 NC_028838 Clostridium phage phiCD506, complete genome 13735-13770 1 0.972
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 LN681538 Clostridium phage phiCD481-1, complete genome 13762-13797 1 0.972
NZ_CP029154_8 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT 1779904-1779940 37 LN681542 Clostridium phage phiMMP03, complete genome 16005-16041 1 0.973
NZ_CP029154_8 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT 1779904-1779940 37 NC_009231 Clostridium phage phiC2, complete genome 16036-16072 1 0.973
NZ_CP029154_8 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT 1779904-1779940 37 LN681541 Clostridium phage phiMMP01, complete genome 16005-16041 1 0.973
NZ_CP029154_9 9.5|1782864|38|NZ_CP029154|CRISPRCasFinder 1782864-1782901 38 HG531805 Clostridium phage CDMH1 complete genome 13828-13865 1 0.974
NZ_CP029154_9 9.6|1782930|37|NZ_CP029154|CRISPRCasFinder 1782930-1782966 37 LN681542 Clostridium phage phiMMP03, complete genome 14215-14251 1 0.973
NZ_CP029154_9 9.6|1782930|37|NZ_CP029154|CRISPRCasFinder 1782930-1782966 37 NC_009231 Clostridium phage phiC2, complete genome 14246-14282 1 0.973
NZ_CP029154_9 9.6|1782930|37|NZ_CP029154|CRISPRCasFinder 1782930-1782966 37 LN681541 Clostridium phage phiMMP01, complete genome 14215-14251 1 0.973
NZ_CP029154_9 9.8|1782866|38|NZ_CP029154|PILER-CR 1782866-1782903 38 HG531805 Clostridium phage CDMH1 complete genome 13828-13865 1 0.974
NZ_CP029154_10 10.3|1924326|35|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924326-1924360 35 MK473382 Clostridium phage JD032, complete genome 7166-7200 1 0.971
NZ_CP029154_10 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924455-1924490 36 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 76310-76345 1 0.972
NZ_CP029154_10 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924455-1924490 36 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 97862-97897 1 0.972
NZ_CP029154_10 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924455-1924490 36 MF547662 Clostridioides phage LIBA6276, complete genome 51715-51750 1 0.972
NZ_CP029154_10 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924455-1924490 36 MF547663 Clostridioides phage LIBA2945, complete genome 51565-51600 1 0.972
NZ_CP029154_10 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924455-1924490 36 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 45655-45690 1 0.972
NZ_CP029154_10 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924455-1924490 36 LN681537 Clostridium phage phiCD211, complete genome 54517-54552 1 0.972
NZ_CP029154_12 12.7|2814301|34|NZ_CP029154|PILER-CR 2814301-2814334 34 LN681539 Clostridium phage phiCD505, complete genome 18064-18097 1 0.971
NZ_CP029154_12 12.7|2814301|34|NZ_CP029154|PILER-CR 2814301-2814334 34 JX145341 Clostridium phage phiMMP02, complete genome 17970-18003 1 0.971
NZ_CP029154_19 19.7|3761261|21|NZ_CP029154|CRT 3761261-3761281 21 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 176923-176943 1 0.952
NZ_CP029154_19 19.8|3761306|21|NZ_CP029154|CRT 3761306-3761326 21 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 176923-176943 1 0.952
NZ_CP029154_7 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT 1688502-1688538 37 KU057941 Clostridium phage CDSH1, complete genome 1888-1924 2 0.946
NZ_CP029154_7 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT 1688502-1688538 37 NC_028905 Clostridium phage phiCD111, complete genome 1916-1952 2 0.946
NZ_CP029154_7 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT 1688502-1688538 37 LN881738 Escherichia phage slur17, complete genome 18513-18549 2 0.946
NZ_CP029154_7 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT 1688568-1688605 38 NC_048665 Clostridium phage phiCDHM14, complete genome 23559-23596 2 0.947
NZ_CP029154_7 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT 1688568-1688605 38 HG796225 Clostridium phage phiCDHM13 complete genome 23060-23097 2 0.947
NZ_CP029154_7 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT 1688568-1688605 38 LN681538 Clostridium phage phiCD481-1, complete genome 22799-22836 2 0.947
NZ_CP029154_7 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT 1688568-1688605 38 HG798901 Clostridium phage phiCDHM11 complete genome 23059-23096 2 0.947
NZ_CP029154_7 7.6|1688766|37|NZ_CP029154|CRISPRCasFinder,CRT 1688766-1688802 37 GU949551 Clostridium phage phiCD6356, complete genome 27126-27162 2 0.946
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 NC_048665 Clostridium phage phiCDHM14, complete genome 13309-13344 2 0.944
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 MK473382 Clostridium phage JD032, complete genome 21368-21403 2 0.944
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 HG796225 Clostridium phage phiCDHM13 complete genome 13277-13312 2 0.944
NZ_CP029154_7 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT 1688962-1688997 36 HG798901 Clostridium phage phiCDHM11 complete genome 13276-13311 2 0.944
NZ_CP029154_7 7.10|1689027|38|NZ_CP029154|CRISPRCasFinder,CRT 1689027-1689064 38 NZ_MG973074 Clostridioides difficile strain HSJD-312 plasmid pHSJD-312, complete sequence 94861-94898 2 0.947
NZ_CP029154_8 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT 1779904-1779940 37 HG531805 Clostridium phage CDMH1 complete genome 17198-17234 2 0.946
NZ_CP029154_8 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder 1779903-1779940 38 LN681542 Clostridium phage phiMMP03, complete genome 16005-16042 2 0.947
NZ_CP029154_8 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder 1779903-1779940 38 NC_009231 Clostridium phage phiC2, complete genome 16036-16073 2 0.947
NZ_CP029154_8 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder 1779903-1779940 38 LN681541 Clostridium phage phiMMP01, complete genome 16005-16042 2 0.947
NZ_CP029154_10 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924196-1924231 36 MF547663 Clostridioides phage LIBA2945, complete genome 118698-118733 2 0.944
NZ_CP029154_10 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924196-1924231 36 CP011970 Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence 117743-117778 2 0.944
NZ_CP029154_10 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924196-1924231 36 LN681537 Clostridium phage phiCD211, complete genome 126605-126640 2 0.944
NZ_CP029154_10 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924196-1924231 36 NZ_CP020426 Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence 4222-4257 2 0.944
NZ_CP029154_10 10.6|1924520|38|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT 1924520-1924557 38 NZ_MF547664 Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence 26432-26469 2 0.947
NZ_CP029154_12 12.7|2814301|34|NZ_CP029154|PILER-CR 2814301-2814334 34 KX228400 Clostridium phage CDKM15, complete genome 21207-21240 2 0.941
NZ_CP029154_7 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT 1688502-1688538 37 NC_028958 Clostridium phage phiCD146, complete genome 1921-1957 3 0.919
NZ_CP029154_8 8.2|1779970|36|NZ_CP029154|PILER-CR,CRT 1779970-1780005 36 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 17906-17941 3 0.917
NZ_CP029154_8 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder 1779903-1779940 38 HG531805 Clostridium phage CDMH1 complete genome 17198-17235 3 0.921
NZ_CP029154_12 12.4|2814300|42|NZ_CP029154|CRT 2814300-2814341 42 NC_048642 Clostridium phage CDKM9, complete genome 18001-18042 3 0.929
NZ_CP029154_4 4.1|811203|33|NZ_CP029154|CRISPRCasFinder 811203-811235 33 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 15023-15055 4 0.879
NZ_CP029154_4 4.1|811203|33|NZ_CP029154|CRISPRCasFinder 811203-811235 33 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 15023-15055 4 0.879
NZ_CP029154_6 6.1|1579028|25|NZ_CP029154|PILER-CR 1579028-1579052 25 MN856115 Bacteriophage sp. isolate 460, complete genome 4078-4102 4 0.84
NZ_CP029154_8 8.5|1779969|37|NZ_CP029154|CRISPRCasFinder 1779969-1780005 37 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 17905-17941 4 0.892
NZ_CP029154_6 6.1|1579028|25|NZ_CP029154|PILER-CR 1579028-1579052 25 NZ_CP051164 Geobacillus subterraneus strain CPW16 plasmid pBsrF30, complete sequence 10038-10062 5 0.8
NZ_CP029154_6 6.1|1579028|25|NZ_CP029154|PILER-CR 1579028-1579052 25 MN693026 Marine virus AFVG_117M72, complete genome 82935-82959 5 0.8
NZ_CP029154_12 12.4|2814300|42|NZ_CP029154|CRT 2814300-2814341 42 LN681539 Clostridium phage phiCD505, complete genome 18063-18104 5 0.881
NZ_CP029154_12 12.4|2814300|42|NZ_CP029154|CRT 2814300-2814341 42 JX145341 Clostridium phage phiMMP02, complete genome 17969-18010 5 0.881
NZ_CP029154_4 4.1|811203|33|NZ_CP029154|CRISPRCasFinder 811203-811235 33 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 13139-13171 6 0.818
NZ_CP029154_4 4.1|811203|33|NZ_CP029154|CRISPRCasFinder 811203-811235 33 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 13139-13171 6 0.818
NZ_CP029154_12 12.4|2814300|42|NZ_CP029154|CRT 2814300-2814341 42 KX228400 Clostridium phage CDKM15, complete genome 21206-21247 6 0.857
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 140-169 6 0.8
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 239-268 6 0.8
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321878-321907 6 0.8
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 MG209611 Aphanizomenon phage vB_AphaS-CL131, complete genome 32379-32408 6 0.8
NZ_CP029154_1 1.1|32118|31|NZ_CP029154|CRISPRCasFinder 32118-32148 31 MT533174 Escherichia phage CJ20, complete genome 109957-109987 7 0.774
NZ_CP029154_12 12.5|2814169|35|NZ_CP029154|PILER-CR 2814169-2814203 35 MN694223 Marine virus AFVG_250M234, complete genome 12543-12577 7 0.8
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 410-439 7 0.767
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 321734-321763 7 0.767
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 72613-72642 7 0.767
NZ_CP029154_12 12.5|2814169|35|NZ_CP029154|PILER-CR 2814169-2814203 35 NZ_CP037437 Lactobacillus plantarum strain EM plasmid pEM8, complete sequence 21202-21236 8 0.771
NZ_CP029154_12 12.5|2814169|35|NZ_CP029154|PILER-CR 2814169-2814203 35 NZ_CP014325 Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence 55631-55665 8 0.771
NZ_CP029154_12 12.7|2814301|34|NZ_CP029154|PILER-CR 2814301-2814334 34 NZ_CP015807 Borrelia mayonii strain MN14-1539 plasmid lp28-4 2137-2170 8 0.765
NZ_CP029154_12 12.7|2814301|34|NZ_CP029154|PILER-CR 2814301-2814334 34 NZ_CP015792 Borrelia mayonii strain MN14-1420 plasmid lp28-4, complete sequence 2137-2170 8 0.765
NZ_CP029154_19 19.2|3760937|30|NZ_CP029154|CRT 3760937-3760966 30 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 73553-73582 8 0.733
NZ_CP029154_12 12.5|2814169|35|NZ_CP029154|PILER-CR 2814169-2814203 35 MN693362 Marine virus AFVG_25M506, complete genome 32054-32088 9 0.743
NZ_CP029154_17 17.1|3262731|31|NZ_CP029154|CRISPRCasFinder 3262731-3262761 31 LR606148 Rhizobium sp. Q54 genome assembly, plasmid: 5 444883-444913 9 0.71
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 NC_025449 Escherichia phage ECML-134, complete genome 64499-64535 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 KM607002 Enterobacteria phage RB55, complete genome 68097-68133 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 KJ477684 Enterobacteria phage T4 strain wild, complete genome 68134-68170 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 HM137666 Enterobacteria phage T4T, complete genome 68133-68169 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 NC_000866 Enterobacteria phage T4, complete genome 68154-68190 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 L13089 Bacteriophage T4 msp1-msp8 genes, complete cds's 2697-2733 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 KJ477686 Enterobacteria phage T4 strain GT7, complete genome 68132-68168 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 X57093 Bacteriophage T4 orfs between tRNA and e genes 238-274 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 KJ477685 Enterobacteria phage T4 strain 147, complete genome 66027-66063 11 0.703
NZ_CP029154_11 11.3|2724359|37|NZ_CP029154|PILER-CR 2724359-2724395 37 KM607003 Enterobacteria phage RB59, complete genome 68110-68146 11 0.703
NZ_CP029154_19 19.3|3760991|48|NZ_CP029154|CRT 3760991-3761038 48 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 90205-90252 15 0.688
NZ_CP029154_20 20.1|4147981|73|NZ_CP029154|CRISPRCasFinder 4147981-4148053 73 NZ_CP033215 Clostridioides difficile strain 12038 plasmid unnamed1, complete sequence 3052-3124 23 0.685

1. spacer 6.1|1579028|25|NZ_CP029154|PILER-CR matches to NZ_MF547664 (Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence) position: , mismatch: 0, identity: 1.0

tattacatctaattctgtctcttca	CRISPR spacer
tattacatctaattctgtctcttca	Protospacer
*************************

2. spacer 6.3|1579017|36|NZ_CP029154|CRISPRCasFinder,CRT matches to NZ_MF547664 (Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence) position: , mismatch: 0, identity: 1.0

aagttaaatttattacatctaattctgtctcttcat	CRISPR spacer
aagttaaatttattacatctaattctgtctcttcat	Protospacer
************************************

3. spacer 7.4|1688635|36|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 0, identity: 1.0

ttggaaataagtataaagacagtgatatggaaatgg	CRISPR spacer
ttggaaataagtataaagacagtgatatggaaatgg	Protospacer
************************************

4. spacer 7.5|1688700|37|NZ_CP029154|CRISPRCasFinder,CRT matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 0, identity: 1.0

tatccatttcatatttagataaaatctctttaaatgc	CRISPR spacer
tatccatttcatatttagataaaatctctttaaatgc	Protospacer
*************************************

5. spacer 9.2|1782864|37|NZ_CP029154|CRT matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 0, identity: 1.0

actaaattagaggtcgagaaggctattgaatcaaaag	CRISPR spacer
actaaattagaggtcgagaaggctattgaatcaaaag	Protospacer
*************************************

6. spacer 9.3|1782930|36|NZ_CP029154|CRT matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 0, identity: 1.0

tacacattttctcaaatttggacttcaattaaaaat	CRISPR spacer
tacacattttctcaaatttggacttcaattaaaaat	Protospacer
************************************

7. spacer 9.3|1782930|36|NZ_CP029154|CRT matches to NC_009231 (Clostridium phage phiC2, complete genome) position: , mismatch: 0, identity: 1.0

tacacattttctcaaatttggacttcaattaaaaat	CRISPR spacer
tacacattttctcaaatttggacttcaattaaaaat	Protospacer
************************************

8. spacer 9.3|1782930|36|NZ_CP029154|CRT matches to LN681541 (Clostridium phage phiMMP01, complete genome) position: , mismatch: 0, identity: 1.0

tacacattttctcaaatttggacttcaattaaaaat	CRISPR spacer
tacacattttctcaaatttggacttcaattaaaaat	Protospacer
************************************

9. spacer 10.2|1924261|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tctatatctgtttcaaaatctgttatgaaatactcc	CRISPR spacer
tctatatctgtttcaaaatctgttatgaaatactcc	Protospacer
************************************

10. spacer 10.2|1924261|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 0, identity: 1.0

tctatatctgtttcaaaatctgttatgaaatactcc	CRISPR spacer
tctatatctgtttcaaaatctgttatgaaatactcc	Protospacer
************************************

11. spacer 10.2|1924261|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 0, identity: 1.0

tctatatctgtttcaaaatctgttatgaaatactcc	CRISPR spacer
tctatatctgtttcaaaatctgttatgaaatactcc	Protospacer
************************************

12. spacer 12.7|2814301|34|NZ_CP029154|PILER-CR matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 0, identity: 1.0

acattatataagatagctaaaaatcttttaggca	CRISPR spacer
acattatataagatagctaaaaatcttttaggca	Protospacer
**********************************

13. spacer 1.1|32118|31|NZ_CP029154|CRISPRCasFinder matches to NZ_CP033215 (Clostridioides difficile strain 12038 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.968

agaataaactgaacgcatgtgaagtttgttt	CRISPR spacer
agaataaactgaacacatgtgaagtttgttt	Protospacer
**************.****************

14. spacer 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 1, identity: 0.973

tacatcctcattaatttctttgctatcccaaacagca	CRISPR spacer
tacatcctcattagtttctttgctatcccaaacagca	Protospacer
*************.***********************

15. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to AY855346 (Clostridium difficile bacteriophage phi CD119, complete genome) position: , mismatch: 1, identity: 0.972

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatgtcaatatcaaggatacaaaattt	Protospacer
******************.*****************

16. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_007917 (Clostridium phage phi CD119, complete genome) position: , mismatch: 1, identity: 0.972

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatgtcaatatcaaggatacaaaattt	Protospacer
******************.*****************

17. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_028996 (Clostridium phage phiCDHM19, complete genome) position: , mismatch: 1, identity: 0.972

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatgtcaatatcaaggatacaaaattt	Protospacer
******************.*****************

18. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_028838 (Clostridium phage phiCD506, complete genome) position: , mismatch: 1, identity: 0.972

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatgtcaatatcaaggatacaaaattt	Protospacer
******************.*****************

19. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to LN681538 (Clostridium phage phiCD481-1, complete genome) position: , mismatch: 1, identity: 0.972

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatgtcaatatcaaggatacaaaattt	Protospacer
******************.*****************

20. spacer 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 1, identity: 0.973

ttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
ttatctgcatcttctgaaatagcatactcttcaagag	Protospacer
********.****************************

21. spacer 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT matches to NC_009231 (Clostridium phage phiC2, complete genome) position: , mismatch: 1, identity: 0.973

ttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
ttatctgcatcttctgaaatagcatactcttcaagag	Protospacer
********.****************************

22. spacer 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT matches to LN681541 (Clostridium phage phiMMP01, complete genome) position: , mismatch: 1, identity: 0.973

ttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
ttatctgcatcttctgaaatagcatactcttcaagag	Protospacer
********.****************************

23. spacer 9.5|1782864|38|NZ_CP029154|CRISPRCasFinder matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 1, identity: 0.974

actaaattagaggtcgagaaggctattgaatcaaaagg	CRISPR spacer
actaaattagaggtcgagaaggctattgaatcaaaaga	Protospacer
*************************************.

24. spacer 9.6|1782930|37|NZ_CP029154|CRISPRCasFinder matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 1, identity: 0.973

tacacattttctcaaatttggacttcaattaaaaatg	CRISPR spacer
tacacattttctcaaatttggacttcaattaaaaata	Protospacer
************************************.

25. spacer 9.6|1782930|37|NZ_CP029154|CRISPRCasFinder matches to NC_009231 (Clostridium phage phiC2, complete genome) position: , mismatch: 1, identity: 0.973

tacacattttctcaaatttggacttcaattaaaaatg	CRISPR spacer
tacacattttctcaaatttggacttcaattaaaaata	Protospacer
************************************.

26. spacer 9.6|1782930|37|NZ_CP029154|CRISPRCasFinder matches to LN681541 (Clostridium phage phiMMP01, complete genome) position: , mismatch: 1, identity: 0.973

tacacattttctcaaatttggacttcaattaaaaatg	CRISPR spacer
tacacattttctcaaatttggacttcaattaaaaata	Protospacer
************************************.

27. spacer 9.8|1782866|38|NZ_CP029154|PILER-CR matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 1, identity: 0.974

actaaattagaggtcgagaaggctattgaatcaaaagg	CRISPR spacer
actaaattagaggtcgagaaggctattgaatcaaaaga	Protospacer
*************************************.

28. spacer 10.3|1924326|35|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to MK473382 (Clostridium phage JD032, complete genome) position: , mismatch: 1, identity: 0.971

aataacttatctatgaaattaaatactgtaacttg	CRISPR spacer
aatagcttatctatgaaattaaatactgtaacttg	Protospacer
****.******************************

29. spacer 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.972

tttcaacagtggtggtggtcgaggagtagaagttct	CRISPR spacer
tttcaacagtggtggtggtcgaggagtagaagtttt	Protospacer
**********************************.*

30. spacer 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.972

tttcaacagtggtggtggtcgaggagtagaagttct	CRISPR spacer
tttcaacagtggtggtggtcgaggagtagaagtttt	Protospacer
**********************************.*

31. spacer 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 1, identity: 0.972

tttcaacagtggtggtggtcgaggagtagaagttct	CRISPR spacer
tttcaacagtggtggtggtcgaggagtagaagtttt	Protospacer
**********************************.*

32. spacer 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 1, identity: 0.972

tttcaacagtggtggtggtcgaggagtagaagttct	CRISPR spacer
tttcaacagtggtggtggtcgaggagtagaagtttt	Protospacer
**********************************.*

33. spacer 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 1, identity: 0.972

tttcaacagtggtggtggtcgaggagtagaagttct	CRISPR spacer
tttcaacagtggtggtggtcgaggagtagaagtttt	Protospacer
**********************************.*

34. spacer 10.5|1924455|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 1, identity: 0.972

tttcaacagtggtggtggtcgaggagtagaagttct	CRISPR spacer
tttcaacagtggtggtggtcgaggagtagaagtttt	Protospacer
**********************************.*

35. spacer 12.7|2814301|34|NZ_CP029154|PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 1, identity: 0.971

acattatataagatagctaaaaatcttttaggca	CRISPR spacer
acattatataagatagctaaaaatcttttaggta	Protospacer
********************************.*

36. spacer 12.7|2814301|34|NZ_CP029154|PILER-CR matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 1, identity: 0.971

acattatataagatagctaaaaatcttttaggca	CRISPR spacer
acattatataagatagctaaaaatcttttaggta	Protospacer
********************************.*

37. spacer 19.7|3761261|21|NZ_CP029154|CRT matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 1, identity: 0.952

taccaaaccatttgctcccgt	CRISPR spacer
taccaaaccagttgctcccgt	Protospacer
********** **********

38. spacer 19.8|3761306|21|NZ_CP029154|CRT matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 1, identity: 0.952

taccaaaccatttgctcccgt	CRISPR spacer
taccaaaccagttgctcccgt	Protospacer
********** **********

39. spacer 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 2, identity: 0.946

tacatcctcattaatttctttgctatcccaaacagca	CRISPR spacer
tacatcctcattagtttctttactatcccaaacagca	Protospacer
*************.*******.***************

40. spacer 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_028905 (Clostridium phage phiCD111, complete genome) position: , mismatch: 2, identity: 0.946

tacatcctcattaatttctttgctatcccaaacagca	CRISPR spacer
tacatcctcattagtttctttactatcccaaacagca	Protospacer
*************.*******.***************

41. spacer 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 2, identity: 0.946

tacatcctcattaatttctttgctatcccaaacagca	CRISPR spacer
tacatcctcattagtttctttactatcccaaacagca	Protospacer
*************.*******.***************

42. spacer 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_048665 (Clostridium phage phiCDHM14, complete genome) position: , mismatch: 2, identity: 0.947

ctcttacgcttttcaatcactttttccttgctaaaatt	CRISPR spacer
cccttacgcttttcaatcattttttccttgctaaaatt	Protospacer
*.*****************.******************

43. spacer 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT matches to HG796225 (Clostridium phage phiCDHM13 complete genome) position: , mismatch: 2, identity: 0.947

ctcttacgcttttcaatcactttttccttgctaaaatt	CRISPR spacer
cccttacgcttttcaatcattttttccttgctaaaatt	Protospacer
*.*****************.******************

44. spacer 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT matches to LN681538 (Clostridium phage phiCD481-1, complete genome) position: , mismatch: 2, identity: 0.947

ctcttacgcttttcaatcactttttccttgctaaaatt	CRISPR spacer
cccttacgcttttcaatcattttttccttgctaaaatt	Protospacer
*.*****************.******************

45. spacer 7.3|1688568|38|NZ_CP029154|CRISPRCasFinder,CRT matches to HG798901 (Clostridium phage phiCDHM11 complete genome) position: , mismatch: 2, identity: 0.947

ctcttacgcttttcaatcactttttccttgctaaaatt	CRISPR spacer
cccttacgcttttcaatcattttttccttgctaaaatt	Protospacer
*.*****************.******************

46. spacer 7.6|1688766|37|NZ_CP029154|CRISPRCasFinder,CRT matches to GU949551 (Clostridium phage phiCD6356, complete genome) position: , mismatch: 2, identity: 0.946

atgttattacataaaaattcttcatctataactttaa	CRISPR spacer
atattattacataaaaattcttcgtctataactttaa	Protospacer
**.********************.*************

47. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_048665 (Clostridium phage phiCDHM14, complete genome) position: , mismatch: 2, identity: 0.944

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatatcaatgtcaagaatacaaaattt	Protospacer
************.***********.***********

48. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to MK473382 (Clostridium phage JD032, complete genome) position: , mismatch: 2, identity: 0.944

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatatcaatgtcaagaatacaaaattt	Protospacer
************.***********.***********

49. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to HG796225 (Clostridium phage phiCDHM13 complete genome) position: , mismatch: 2, identity: 0.944

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatatcaatgtcaagaatacaaaattt	Protospacer
************.***********.***********

50. spacer 7.9|1688962|36|NZ_CP029154|CRISPRCasFinder,CRT matches to HG798901 (Clostridium phage phiCDHM11 complete genome) position: , mismatch: 2, identity: 0.944

tatatattagatgtcaatgtcaaggatacaaaattt	CRISPR spacer
tatatattagatatcaatgtcaagaatacaaaattt	Protospacer
************.***********.***********

51. spacer 7.10|1689027|38|NZ_CP029154|CRISPRCasFinder,CRT matches to NZ_MG973074 (Clostridioides difficile strain HSJD-312 plasmid pHSJD-312, complete sequence) position: , mismatch: 2, identity: 0.947

ccatcttttgttgctttacataaatttatattacttac	CRISPR spacer
ccatcttttgttgctttgcatagatttatattacttac	Protospacer
*****************.****.***************

52. spacer 8.1|1779904|37|NZ_CP029154|PILER-CR,CRT matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 2, identity: 0.946

ttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
ttttctgcatcttctgaaatagcatactcttcaagag	Protospacer
** *****.****************************

53. spacer 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder matches to LN681542 (Clostridium phage phiMMP03, complete genome) position: , mismatch: 2, identity: 0.947

tttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
attatctgcatcttctgaaatagcatactcttcaagag	Protospacer
 ********.****************************

54. spacer 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder matches to NC_009231 (Clostridium phage phiC2, complete genome) position: , mismatch: 2, identity: 0.947

tttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
attatctgcatcttctgaaatagcatactcttcaagag	Protospacer
 ********.****************************

55. spacer 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder matches to LN681541 (Clostridium phage phiMMP01, complete genome) position: , mismatch: 2, identity: 0.947

tttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
attatctgcatcttctgaaatagcatactcttcaagag	Protospacer
 ********.****************************

56. spacer 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 2, identity: 0.944

attgttttaccttctaaaaggtcacatatatttatt	CRISPR spacer
attatttcaccttctaaaaggtcacatatatttatt	Protospacer
***.***.****************************

57. spacer 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 2, identity: 0.944

attgttttaccttctaaaaggtcacatatatttatt	CRISPR spacer
attgtttcaccttctaaaatgtcacatatatttatt	Protospacer
*******.*********** ****************

58. spacer 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 2, identity: 0.944

attgttttaccttctaaaaggtcacatatatttatt	CRISPR spacer
attgtttcaccttctaaaatgtcacatatatttatt	Protospacer
*******.*********** ****************

59. spacer 10.1|1924196|36|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.944

attgttttaccttctaaaaggtcacatatatttatt	CRISPR spacer
attgtttcaccttctaaaatgtcacatatatttatt	Protospacer
*******.*********** ****************

60. spacer 10.6|1924520|38|NZ_CP029154|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MF547664 (Clostridioides difficile strain LIBA-6289 plasmid LIBA6289, complete sequence) position: , mismatch: 2, identity: 0.947

tttataacctttaattacacctcccatatcaccaccac	CRISPR spacer
cttgtaacctttaattacacctcccatatcaccaccac	Protospacer
.**.**********************************

61. spacer 12.7|2814301|34|NZ_CP029154|PILER-CR matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 2, identity: 0.941

acattatataagatagctaaaaatcttttaggca	CRISPR spacer
acattatataagatagctaaaaatctcttaggta	Protospacer
**************************.*****.*

62. spacer 7.2|1688502|37|NZ_CP029154|CRISPRCasFinder,CRT matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 3, identity: 0.919

tacatcctcattaatttctttgctatcccaaacagca	CRISPR spacer
tatatcctcattagtttctttgctatcccaaacagcg	Protospacer
**.**********.**********************.

63. spacer 8.2|1779970|36|NZ_CP029154|PILER-CR,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.917

gttgtaagaagtatcattctattttttaatctttct	CRISPR spacer
attggaggaagtatcattctattttttaatctttct	Protospacer
.*** *.*****************************

64. spacer 8.4|1779903|38|NZ_CP029154|CRISPRCasFinder matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 3, identity: 0.921

tttatctgcgtcttctgaaatagcatactcttcaagag	CRISPR spacer
attttctgcatcttctgaaatagcatactcttcaagag	Protospacer
 ** *****.****************************

65. spacer 12.4|2814300|42|NZ_CP029154|CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 3, identity: 0.929

tacattatataagatagctaaaaatcttttaggcaaatttac	CRISPR spacer
tacattatataagatagctaaaaatcttttaggcaaaggttc	Protospacer
*************************************  * *

66. spacer 4.1|811203|33|NZ_CP029154|CRISPRCasFinder matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 4, identity: 0.879

aatgactcaaaagcagttactggatggcaaacc	CRISPR spacer
aataactcaaaagcagttacgggatggcaaatt	Protospacer
***.**************** **********..

67. spacer 4.1|811203|33|NZ_CP029154|CRISPRCasFinder matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 4, identity: 0.879

aatgactcaaaagcagttactggatggcaaacc	CRISPR spacer
aataactcaaaagcagttacgggatggcaaatt	Protospacer
***.**************** **********..

68. spacer 6.1|1579028|25|NZ_CP029154|PILER-CR matches to MN856115 (Bacteriophage sp. isolate 460, complete genome) position: , mismatch: 4, identity: 0.84

tattacatctaattctgtctcttca	CRISPR spacer
cattacatctaattctttctcatct	Protospacer
.*************** **** ** 

69. spacer 8.5|1779969|37|NZ_CP029154|CRISPRCasFinder matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.892

tgttgtaagaagtatcattctattttttaatctttct	CRISPR spacer
aattggaggaagtatcattctattttttaatctttct	Protospacer
 .*** *.*****************************

70. spacer 6.1|1579028|25|NZ_CP029154|PILER-CR matches to NZ_CP051164 (Geobacillus subterraneus strain CPW16 plasmid pBsrF30, complete sequence) position: , mismatch: 5, identity: 0.8

tattacatctaattctgtctcttca	CRISPR spacer
aattgcatctaattctgtctctaat	Protospacer
 ***.*****************   

71. spacer 6.1|1579028|25|NZ_CP029154|PILER-CR matches to MN693026 (Marine virus AFVG_117M72, complete genome) position: , mismatch: 5, identity: 0.8

tattacatctaattctgtctcttca	CRISPR spacer
cattacatctaattctttctctaat	Protospacer
.*************** *****   

72. spacer 12.4|2814300|42|NZ_CP029154|CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 5, identity: 0.881

tacattatataagatagctaaaaatcttttaggcaaatttac	CRISPR spacer
tacattatataagatagctaaaaatcttttaggtaagggttc	Protospacer
*********************************.**.  * *

73. spacer 12.4|2814300|42|NZ_CP029154|CRT matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 5, identity: 0.881

tacattatataagatagctaaaaatcttttaggcaaatttac	CRISPR spacer
tacattatataagatagctaaaaatcttttaggtaagggttc	Protospacer
*********************************.**.  * *

74. spacer 4.1|811203|33|NZ_CP029154|CRISPRCasFinder matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 6, identity: 0.818

aatgactcaaaagcagttactggatggcaaacc	CRISPR spacer
tctagctcaaaagcagttacgggatggcaaact	Protospacer
  *..*************** ***********.

75. spacer 4.1|811203|33|NZ_CP029154|CRISPRCasFinder matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 6, identity: 0.818

aatgactcaaaagcagttactggatggcaaacc	CRISPR spacer
tctagctcaaaagcagttacgggatggcaaact	Protospacer
  *..*************** ***********.

76. spacer 12.4|2814300|42|NZ_CP029154|CRT matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 6, identity: 0.857

tacattatataagatagctaaaaatcttttaggcaaatttac	CRISPR spacer
tacattatataagatagctaaaaatctcttaggtaagggttc	Protospacer
***************************.*****.**.  * *

77. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.8

tgctactccatttgctcccgttgctcctac	CRISPR spacer
cgttactcctgttgctcccgttgctcctgt	Protospacer
.*.******  *****************..

78. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 6, identity: 0.8

tgctactccatttgctcccgttgctcctac	CRISPR spacer
cgttactcctgttgctcccgttgctcctgt	Protospacer
.*.******  *****************..

79. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 6, identity: 0.8

tgctactccatttgctcccgttgctcctac	CRISPR spacer
cgttactcctgttgctcccgttgctcctgt	Protospacer
.*.******  *****************..

80. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to MG209611 (Aphanizomenon phage vB_AphaS-CL131, complete genome) position: , mismatch: 6, identity: 0.8

tgctactccatttgctcccgttgctcctac	CRISPR spacer
cgttgctcccgttgctcccgttgctcctat	Protospacer
.*.*.****  ******************.

81. spacer 1.1|32118|31|NZ_CP029154|CRISPRCasFinder matches to MT533174 (Escherichia phage CJ20, complete genome) position: , mismatch: 7, identity: 0.774

agaataaactgaacgcatgtgaagtttgttt	CRISPR spacer
caattaacccgaacgcatgtgaagtttatat	Protospacer
 .* *** *.*****************.* *

82. spacer 12.5|2814169|35|NZ_CP029154|PILER-CR matches to MN694223 (Marine virus AFVG_250M234, complete genome) position: , mismatch: 7, identity: 0.8

ttaaag---ctacataataaaaaattaagaaaaagaaa	CRISPR spacer
---aagttcctacaaaataaaaaattaaaaaaaatata	Protospacer
   ***   ***** *************.***** * *

83. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 7, identity: 0.767

tgctactccatttgctcccgttgctcctac	CRISPR spacer
cgtcactcctgttgctcccgttgctcctgt	Protospacer
.*..*****  *****************..

84. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 7, identity: 0.767

tgctactccatttgctcccgttgctcctac	CRISPR spacer
cgtcactcctgttgctcccgttgctcctgt	Protospacer
.*..*****  *****************..

85. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

tgctactccatttgctcccgttgctcctac	CRISPR spacer
aattgctccgattgctcccgttgctcctgc	Protospacer
 ..*.****. *****************.*

86. spacer 12.5|2814169|35|NZ_CP029154|PILER-CR matches to NZ_CP037437 (Lactobacillus plantarum strain EM plasmid pEM8, complete sequence) position: , mismatch: 8, identity: 0.771

----ttaaagctacataataaaaaattaagaaaaagaaa	CRISPR spacer
cttgttag----atataataaaaaatcaataaaaagaaa	Protospacer
    ***.    *.************.** *********

87. spacer 12.5|2814169|35|NZ_CP029154|PILER-CR matches to NZ_CP014325 (Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence) position: , mismatch: 8, identity: 0.771

ttaaagctac---ataataaaaaattaagaaaaagaaa	CRISPR spacer
---aacttatgagataataaaaacttaacaaaaagaaa	Protospacer
   ** .**.   ********** **** *********

88. spacer 12.7|2814301|34|NZ_CP029154|PILER-CR matches to NZ_CP015807 (Borrelia mayonii strain MN14-1539 plasmid lp28-4) position: , mismatch: 8, identity: 0.765

acattatataagatagctaaaaatcttttaggca	CRISPR spacer
taaatatataaaatagctaaaaatcatttatcaa	Protospacer
  * *******.************* ****   *

89. spacer 12.7|2814301|34|NZ_CP029154|PILER-CR matches to NZ_CP015792 (Borrelia mayonii strain MN14-1420 plasmid lp28-4, complete sequence) position: , mismatch: 8, identity: 0.765

acattatataagatagctaaaaatcttttaggca	CRISPR spacer
taaatatataaaatagctaaaaatcatttatcaa	Protospacer
  * *******.************* ****   *

90. spacer 19.2|3760937|30|NZ_CP029154|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733

tgctactccatttgctcccgttgctcctac	CRISPR spacer
ggtcgctcccgttgctcccgttgctccttt	Protospacer
 *...****  ***************** .

91. spacer 12.5|2814169|35|NZ_CP029154|PILER-CR matches to MN693362 (Marine virus AFVG_25M506, complete genome) position: , mismatch: 9, identity: 0.743

ttaaagctacataataaaaaattaagaaaaagaaa	CRISPR spacer
tgtaataaacataatcaaaaattatgaaaaagatt	Protospacer
*  **   ******* ******** ********  

92. spacer 17.1|3262731|31|NZ_CP029154|CRISPRCasFinder matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.71

cactatctctggtattggcggatttatcata	CRISPR spacer
cgagcaacttggtattggcggatttatgata	Protospacer
*.     ..****************** ***

93. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to NC_025449 (Escherichia phage ECML-134, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cactccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

94. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to KM607002 (Enterobacteria phage RB55, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

95. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to KJ477684 (Enterobacteria phage T4 strain wild, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

96. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to HM137666 (Enterobacteria phage T4T, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

97. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to NC_000866 (Enterobacteria phage T4, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

98. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to L13089 (Bacteriophage T4 msp1-msp8 genes, complete cds's) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

99. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to KJ477686 (Enterobacteria phage T4 strain GT7, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

100. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to X57093 (Bacteriophage T4 orfs between tRNA and e genes) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

101. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to KJ477685 (Enterobacteria phage T4 strain 147, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

102. spacer 11.3|2724359|37|NZ_CP029154|PILER-CR matches to KM607003 (Enterobacteria phage RB59, complete genome) position: , mismatch: 11, identity: 0.703

ataataaaacttctattatatctactatatcaatatt	CRISPR spacer
cgctccaaacttctattatatctactgtaccactgat	Protospacer
    . ********************.**.** *. *

103. spacer 19.3|3760991|48|NZ_CP029154|CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 15, identity: 0.688

atttgcccctgttgctcctgttgctcctgtagctcctgctactccatt---------	CRISPR spacer
---------tgttgctcctgttgctcctgttgctcctgttgctcctccagcaggtcc	Protospacer
         ********************* *******.*.**** ..         

104. spacer 20.1|4147981|73|NZ_CP029154|CRISPRCasFinder matches to NZ_CP033215 (Clostridioides difficile strain 12038 plasmid unnamed1, complete sequence) position: , mismatch: 23, identity: 0.685

-ggataaatcccgttgcttaaagtgctaacgcacagcgccaacaaacaaacttcacatgc	CRISPR spacer
tatatatatgcagtt-ttcaaagtgctaacgcacagcgccaacaaacaaacttcacatgt	Protospacer
 . *** ** * *** .*.****************************************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 273724 : 285520 9 Synechococcus_phage(37.5%) NA NA
DBSCAN-SWA_2 397193 : 415671 20 Streptococcus_phage(100.0%) integrase attL 393695:393712|attR 415683:415700
DBSCAN-SWA_3 1455368 : 1527927 69 Clostridium_phage(44.44%) tRNA,portal,plate,tail,integrase,protease attL 1454921:1454939|attR 1529404:1529422
DBSCAN-SWA_4 1609338 : 1619067 11 Pandoravirus(37.5%) NA NA
DBSCAN-SWA_5 1744713 : 1800305 59 Clostridium_phage(82.35%) portal,plate,tail,integrase,terminase,capsid attL 1746548:1746575|attR 1801654:1801681
DBSCAN-SWA_6 2556288 : 2570429 17 Clostridium_phage(71.43%) integrase attL 2562606:2562622|attR 2577323:2577339
DBSCAN-SWA_7 2808767 : 2816536 8 Clostridium_phage(57.14%) holin NA
DBSCAN-SWA_8 3017468 : 3077283 88 Clostridium_phage(96.39%) portal,holin,plate,tail,integrase,terminase,capsid attL 3015757:3015774|attR 3083374:3083391
DBSCAN-SWA_9 3176911 : 3185864 8 Catovirus(50.0%) NA NA
DBSCAN-SWA_10 3627293 : 3663815 47 Clostridium_phage(79.49%) portal,holin,plate,tail,integrase,head,protease,terminase,capsid attL 3652169:3652186|attR 3672979:3672996
DBSCAN-SWA_11 3869599 : 3891058 31 Streptococcus_phage(91.3%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP029154.1|WP_021370739.1|3072614_3072824_-|hypothetical-protein 3072614_3072824_- 69 aa aa NA NA NA 3017468-3077283 yes
3. NZ_CP029155
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 92 : 72534 100 Clostridium_phage(51.16%) integrase attL 1340:1361|attR 58639:58660
DBSCAN-SWA_2 85436 : 130304 48 Clostridioides_phage(56.25%) protease,integrase,transposase,tail attL 99149:99168|attR 116374:116393
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage