Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029560 Streptococcus sobrinus strain NIDR 6715-7 chromosome, complete genome 2 crisprs DEDDh,cas3,csa3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,csm6,DinG 0 4 4 0

Results visualization

1. NZ_CP029560
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029560_1 448566-448649 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029560_2 852544-853244 TypeI-E I-C,I-E,II-B
11 spacers
DEDDh,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029560_1 1.1|448595|26|NZ_CP029560|CRISPRCasFinder 448595-448620 26 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 159084-159109 6 0.769
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 MN694191 Marine virus AFVG_250M444, complete genome 25897-25928 8 0.75
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 MN694065 Marine virus AFVG_250M443, complete genome 30835-30866 8 0.75
NZ_CP029560_2 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT 852695-852726 32 NC_031062 Erwinia phage vB_EamP_Frozen, complete genome 17077-17108 9 0.719
NZ_CP029560_2 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT 852695-852726 32 KX098391 Erwinia phage vB_EamP_Gutmeister, complete genome 13100-13131 9 0.719
NZ_CP029560_2 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT 852695-852726 32 KX098390 Erwinia phage vB_EamP_Rexella, complete genome 16892-16923 9 0.719
NZ_CP029560_2 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT 852695-852726 32 KF806588 Erwinia phage Ea9-2, complete genome 17499-17530 9 0.719
NZ_CP029560_2 2.6|852879|32|NZ_CP029560|CRISPRCasFinder,CRT 852879-852910 32 NC_008043 Ruegeria sp. TM1040 megaplasmid, complete sequence 336350-336381 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 LC494302 Escherichia phage SP27 DNA, complete genome 312993-313024 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 163545-163576 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 NC_027364 Escherichia phage PBECO 4, complete genome 317674-317705 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 MH383160 Escherichia phage UB, complete genome 30812-30843 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 MK327931 Escherichia phage vB_EcoM_G17, complete genome 188849-188880 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 254502-254533 10 0.688
NZ_CP029560_2 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT 853184-853215 32 KM507819 Escherichia phage 121Q, complete genome 313629-313660 10 0.688

1. spacer 1.1|448595|26|NZ_CP029560|CRISPRCasFinder matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 6, identity: 0.769

tttcatttccaacttttgacagtctc	CRISPR spacer
tttcatttacaacttttgacatctct	Protospacer
******** ************ ....

2. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to MN694191 (Marine virus AFVG_250M444, complete genome) position: , mismatch: 8, identity: 0.75

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
tatacttgggatgataactggtacgaagacga	Protospacer
 .* .* ****** ************* ** *

3. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to MN694065 (Marine virus AFVG_250M443, complete genome) position: , mismatch: 8, identity: 0.75

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
tatacttgggatgataactggtacgaagacga	Protospacer
 .* .* ****** ************* ** *

4. spacer 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT matches to NC_031062 (Erwinia phage vB_EamP_Frozen, complete genome) position: , mismatch: 9, identity: 0.719

agaataccatccacctgagtagtagcgagagg	CRISPR spacer
cacgtaccatccacctgagcagtagggatatc	Protospacer
 . .***************.***** ** *  

5. spacer 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT matches to KX098391 (Erwinia phage vB_EamP_Gutmeister, complete genome) position: , mismatch: 9, identity: 0.719

agaataccatccacctgagtagtagcgagagg	CRISPR spacer
cacgtaccatccacctgagcagtagggatatc	Protospacer
 . .***************.***** ** *  

6. spacer 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT matches to KX098390 (Erwinia phage vB_EamP_Rexella, complete genome) position: , mismatch: 9, identity: 0.719

agaataccatccacctgagtagtagcgagagg	CRISPR spacer
cacgtaccatccacctgagcagtagggatatc	Protospacer
 . .***************.***** ** *  

7. spacer 2.3|852695|32|NZ_CP029560|PILER-CR,CRISPRCasFinder,CRT matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 9, identity: 0.719

agaataccatccacctgagtagtagcgagagg	CRISPR spacer
cacgtaccatccacctgagcagtagggatatc	Protospacer
 . .***************.***** ** *  

8. spacer 2.6|852879|32|NZ_CP029560|CRISPRCasFinder,CRT matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ggtctatctggtcaaggttcttgacagaagta	CRISPR spacer
caattatctgatcaaggttcatgacagcccaa	Protospacer
 . .******.********* ******    *

9. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

10. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

11. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

12. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

13. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

14. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

15. spacer 2.11|853184|32|NZ_CP029560|CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 10, identity: 0.688

ggttttggggatgctaactggtacgaatacta	CRISPR spacer
gacccgatggatgctaactggtatgaaaactt	Protospacer
*.... . ***************.*** *** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 487538 : 496422 10 Streptococcus_phage(71.43%) transposase NA
DBSCAN-SWA_2 956044 : 1005918 55 Lactococcus_phage(11.11%) transposase,bacteriocin,tRNA,protease NA
DBSCAN-SWA_3 1256649 : 1264045 8 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_4 1474441 : 1546024 57 Staphylococcus_phage(15.38%) transposase,bacteriocin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage