Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030172 Klebsiella pneumoniae subsp. pneumoniae strain 12208 chromosome, complete genome 2 crisprs csa3,cas3,DEDDh,RT,DinG,WYL 0 1 4 0

Results visualization

1. NZ_CP030172
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030172_1 3847509-3847604 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030172_2 4333390-4333484 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030172_1 1.1|3847539|36|NZ_CP030172|CRISPRCasFinder 3847539-3847574 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP030172_1 1.1|3847539|36|NZ_CP030172|CRISPRCasFinder 3847539-3847574 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP030172_1 1.1|3847539|36|NZ_CP030172|CRISPRCasFinder 3847539-3847574 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|3847539|36|NZ_CP030172|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|3847539|36|NZ_CP030172|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|3847539|36|NZ_CP030172|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1617577 : 1624482 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_2 2634026 : 2643441 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_3 3321530 : 3330993 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_4 3811916 : 3860353 67 Cronobacter_phage(23.4%) coat,lysis,tRNA,integrase,head attL 3810044:3810060|attR 3867568:3867584
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage