Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031108 Escherichia coli strain AMSCJX02 plasmid pAMSC3, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP031110 Escherichia coli strain AMSCJX02 plasmid pAMSC5, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP031107 Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP031109 Escherichia coli strain AMSCJX02 plasmid pAMSC4, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP031111 Escherichia coli strain AMSCJX02 plasmid pAMSC6, complete sequence 0 crisprs WYL,RT 0 0 0 0
NZ_CP031105 Escherichia coli strain AMSCJX02 chromosome, complete genome 4 crisprs c2c9_V-U4,DinG,DEDDh,cas3,csa3,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,WYL 0 8 10 0
NZ_CP031106 Escherichia coli strain AMSCJX02 plasmid pAMSC1, complete sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. NZ_CP031107
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 66038 : 119948 43 Macacine_betaherpesvirus(36.36%) integrase,transposase,protease attL 80699:80718|attR 133678:133697
DBSCAN-SWA_2 152445 : 180083 20 Stx2-converting_phage(37.5%) transposase,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031108
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 930 : 5040 8 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_2 9470 : 27005 23 Escherichia_phage(95.45%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP031110
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3021 : 14113 8 Enterobacteria_phage(42.86%) integrase,transposase attL 1171:1182|attR 12389:12400

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP031105
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031105_1 1275312-1276194 TypeI-E I-E
14 spacers
cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031105_2 1301912-1302184 Unclear I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031105_3 3137576-3137691 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031105_4 3649172-3649268 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031105_1 1.1|1275341|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275341-1275372 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
NZ_CP031105_1 1.2|1275402|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275402-1275433 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
NZ_CP031105_1 1.5|1275585|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275585-1275616 32 NZ_CP015609 Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence 10946-10977 6 0.812
NZ_CP031105_1 1.5|1275585|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275585-1275616 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 305380-305411 6 0.812
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_AP014659 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence 89317-89348 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_AP014659 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence 149653-149684 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_AP014686 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence 101093-101124 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_AP014686 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence 141992-142023 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_AP014688 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6d, complete sequence 99321-99352 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 142212-142243 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 161765-161796 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 175817-175848 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 140186-140217 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 188728-188759 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 267789-267820 7 0.781
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP049702 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence 70012-70043 7 0.781
NZ_CP031105_2 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT 1301941-1301972 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP031105_1 1.2|1275402|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275402-1275433 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 KT221034 Streptomyces phage SF3, complete genome 42881-42912 8 0.75
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 149701-149732 8 0.75
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 797644-797675 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1077804-1077835 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1081182-1081213 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1264658-1264689 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1083481-1083512 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1080184-1080215 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 909207-909238 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1059848-1059879 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1059871-1059902 8 0.75
NZ_CP031105_2 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT 1301941-1301972 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57773 8 0.75
NZ_CP031105_1 1.2|1275402|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275402-1275433 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 JN698994 Mycobacterium phage DS6A, complete genome 24764-24795 9 0.719
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP019604 Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence 45733-45764 9 0.719
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP025432 Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence 92571-92602 9 0.719
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 AY526908 Bordetella phage BMP-1, complete genome 4333-4364 9 0.719
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NC_005357 Bordetella phage BPP-1, complete genome 4333-4364 9 0.719
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 AY526909 Bordetella phage BIP-1, complete genome 4333-4364 9 0.719
NZ_CP031105_2 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT 1301941-1301972 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60757-60788 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41217-41248 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-728 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41217-41248 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184797 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54225-54256 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46038-46069 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51662-51693 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26853 9 0.719
NZ_CP031105_2 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302063-1302094 32 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145953-145984 9 0.719
NZ_CP031105_2 2.4|1302124|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR 1302124-1302155 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52228 9 0.719
NZ_CP031105_1 1.5|1275585|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275585-1275616 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 74068-74099 10 0.688
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 74612-74643 10 0.688
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 74612-74643 10 0.688
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NC_030916 Tsukamurella phage TPA4, complete genome 18471-18502 10 0.688
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 AB276040 Ralstonia phage RSA1 DNA, complete genome 989-1020 10 0.688
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NC_009382 Ralstonia phage phiRSA1, complete genome 989-1020 10 0.688
NZ_CP031105_1 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275951-1275982 32 NZ_CP025433 Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence 97047-97078 10 0.688
NZ_CP031105_2 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT 1301941-1301972 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 524692-524723 11 0.656
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 315738-315769 11 0.656
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 522528-522559 11 0.656
NZ_CP031105_1 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT 1275646-1275677 32 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 357216-357247 11 0.656

1. spacer 1.1|1275341|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

2. spacer 1.2|1275402|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..**

3. spacer 1.5|1275585|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015609 (Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

gcagtggtgaggccgggaagcgcggttgagtc	CRISPR spacer
ggattggtcaggccgggaagcgcggttgccgc	Protospacer
* * **** *******************   *

4. spacer 1.5|1275585|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812 

gcagtggtgaggccgggaagcgcggttgagtc	CRISPR spacer
ggattggtcaggccgggaagcgcggttgccgc	Protospacer
* * **** *******************   *

5. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

6. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

7. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014686 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

8. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014686 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6b, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

9. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014688 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6d, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

10. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

11. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

12. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

13. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

14. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

15. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

16. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049702 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2c, complete sequence) position: , mismatch: 7, identity: 0.781 

-tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
gtggtc-tcgacgacacgggcggcgattttcaa	Protospacer
 **.**  *** ***** *************.

17. spacer 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

18. spacer 1.2|1275402|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .*

19. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 8, identity: 0.75 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatccgcgaggacaccggcgacgagctgtac	Protospacer
***** ***************.*** .* ...

20. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatcagccagggcaccggcggcggctacggc	Protospacer
******** ***.***********..* . *.

21. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.75 

tgatcagcgaggacaccggcggcgattttcgt----	CRISPR spacer
tgatcagcaaggacaccgacggca----tcgcggcc	Protospacer
********.*********.****.    ***.

22. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

23. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

24. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

25. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

26. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

27. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

28. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

29. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

30. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

31. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

32. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

33. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
accagcagcgtgcaggctggcgcccgatcctc	Protospacer
 * . ****** *********.****** .**

34. spacer 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

35. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 8, identity: 0.75 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgatggag	Protospacer
*** *********** ******** .*   *

36. spacer 1.2|1275402|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **

37. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to JN698994 (Mycobacterium phage DS6A, complete genome) position: , mismatch: 9, identity: 0.719 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
ggaccagcgaggccaccggcggcggctacggg	Protospacer
 **.******** ***********..* . *

38. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
gcgcgacacgtccaggctgccacccgatgttg	Protospacer
 **    .*********** ********.**

39. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 9, identity: 0.719 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
atggccagcatcgaggctggcaccccggtttg	Protospacer
 .*******.** ************ .  **

40. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to AY526908 (Bordetella phage BMP-1, complete genome) position: , mismatch: 9, identity: 0.719 

tcggccagcgtccaggctggcacccgatattc----	CRISPR spacer
acggccagcatcaaggctggcacc----atcgtgga	Protospacer
 ********.** ***********    **.

41. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NC_005357 (Bordetella phage BPP-1, complete genome) position: , mismatch: 9, identity: 0.719 

tcggccagcgtccaggctggcacccgatattc----	CRISPR spacer
acggccagcatcaaggctggcacc----atcgtgga	Protospacer
 ********.** ***********    **.

42. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to AY526909 (Bordetella phage BIP-1, complete genome) position: , mismatch: 9, identity: 0.719 

tcggccagcgtccaggctggcacccgatattc----	CRISPR spacer
acggccagcatcaaggctggcacc----atcgtgga	Protospacer
 ********.** ***********    **.

43. spacer 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

44. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

45. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

46. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

47. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

48. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggcg	Protospacer
*** *********** ******** .*

49. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

50. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

51. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

52. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*

53. spacer 2.3|1302063|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggcg	Protospacer
*** *********** ******** .*

54. spacer 2.4|1302124|32|NZ_CP031105|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gactggtacggcccgtgggagcgtgtgatcgg	CRISPR spacer
gactggtccggccggtgggagcggctgccgaa	Protospacer
******* ***** *********  ** . ..

55. spacer 1.5|1275585|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 10, identity: 0.688 

gcagtggtgaggccgggaagcgcggttgagtc	CRISPR spacer
tgcgtggtgcgcccgggaagcgcggtgtcgca	Protospacer
   ****** * **************   *.

56. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatcagcgcggccaccggcggcagcgtgtag	Protospacer
********* ** **********... * ..

57. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatcagcgcggccaccggcggcagcgtgtag	Protospacer
********* ** **********... * ..

58. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NC_030916 (Tsukamurella phage TPA4, complete genome) position: , mismatch: 10, identity: 0.688 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
cgatcggcgaggacaccggcgtcggcctgatc	Protospacer
.****.*************** **...*   .

59. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 10, identity: 0.688 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
cgatcagccaggacaccgccggcgcccatgtc	Protospacer
.******* ********* ***** .. *  .

60. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 10, identity: 0.688 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
cgatcagccaggacaccgccggcgcccatgtc	Protospacer
.******* ********* ***** .. *  .

61. spacer 1.11|1275951|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025433 (Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence) position: , mismatch: 10, identity: 0.688 

tcggccagcgtccaggctggcacccgatattc	CRISPR spacer
atggccagcatcgaggctggcaccccggtctg	Protospacer
 .*******.** ************ .  .*

62. spacer 2.1|1301941|32|NZ_CP031105|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******

63. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatcagcgcggccaccggcggcagcgagtac	Protospacer
********* ** **********...   ...

64. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatcagcgaggaccccggccgctggcgcgag	Protospacer
************** ***** ** . . . .

65. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
tgatcagcgcggccaccggcggcagcgagtac	Protospacer
********* ** **********...   ...

66. spacer 1.6|1275646|32|NZ_CP031105|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 11, identity: 0.656 

tgatcagcgaggacaccggcggcgattttcgt	CRISPR spacer
ccgtcagcgaggacatcggcgccgatcagacg	Protospacer
. .************.***** ****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 349739 : 448712 103 Escherichia_phage(49.02%) terminase,integrase,capsid,tail,head,holin,portal,protease,transposase attL 375370:375386|attR 442836:442852
DBSCAN-SWA_2 611691 : 619999 9 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_3 825558 : 886955 45 Shigella_phage(28.57%) integrase,transposase,tRNA attL 858500:858518|attR 899401:899419
DBSCAN-SWA_4 1042038 : 1048252 8 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_5 1251815 : 1258955 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_6 2501435 : 2582051 92 Escherichia_phage(32.0%) terminase,integrase,capsid,tail,lysis,head,holin,plate,transposase,portal,protease,tRNA attL 2532109:2532155|attR 2566108:2566154
DBSCAN-SWA_7 3353227 : 3365682 13 Enterobacteria_phage(37.5%) integrase attL 3355366:3355380|attR 3366741:3366755
DBSCAN-SWA_8 3618231 : 3682203 61 Enterobacteria_phage(46.43%) terminase,tail,lysis,head,portal,protease,tRNA NA
DBSCAN-SWA_9 4483125 : 4517261 39 Escherichia_phage(62.5%) integrase,tail,lysis,tRNA,transposase attL 4485093:4485107|attR 4506243:4506257
DBSCAN-SWA_10 4728567 : 4779002 65 Enterobacteria_phage(48.98%) terminase,tail,lysis,portal,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP031109
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 16957 : 26137 9 Escherichia_phage(28.57%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage