Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP030112 Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75A, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP030116 Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75E, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP030113 Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75B, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP030115 Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75D, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP030111 Escherichia coli strain MCJCHV-1 chromosome, complete genome 5 crisprs csa3,cas3,DEDDh,DinG,cas14j,RT,WYL 0 4 9 0
NZ_CP030114 Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP030112
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17500 : 60908 43 Macacine_betaherpesvirus(28.57%) transposase,integrase,protease attL 10576:10591|attR 63630:63645

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP030111
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030111_1 1647086-1647203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030111_2 2303231-2303354 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030111_3 3115756-3115906 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030111_4 4003288-4003420 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP030111_5 4222480-4222629 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP030111_4 4.1|4003305|42|NZ_CP030111|PILER-CR 4003305-4003346 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP030111_4 4.2|4003364|40|NZ_CP030111|PILER-CR 4003364-4003403 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP030111_2 2.1|2303274|38|NZ_CP030111|CRISPRCasFinder 2303274-2303311 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP030111_3 3.1|3115784|32|NZ_CP030111|CRISPRCasFinder 3115784-3115815 32 NC_015163 Deinococcus proteolyticus MRP plasmid pDEIPR04, complete sequence 83332-83363 8 0.75
NZ_CP030111_4 4.2|4003364|40|NZ_CP030111|PILER-CR 4003364-4003403 40 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 143235-143274 11 0.725

1. spacer 4.1|4003305|42|NZ_CP030111|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976 

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 4.2|4003364|40|NZ_CP030111|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975 

catggcgtagaaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********************************.*******

3. spacer 2.1|2303274|38|NZ_CP030111|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 3.1|3115784|32|NZ_CP030111|CRISPRCasFinder matches to NC_015163 (Deinococcus proteolyticus MRP plasmid pDEIPR04, complete sequence) position: , mismatch: 8, identity: 0.75 

ttgtcattattggcagacaggatccgcggcaa	CRISPR spacer
ttgtcaaaattggcagacaggatgccgtccag	Protospacer
******  *************** *    **.

5. spacer 4.2|4003364|40|NZ_CP030111|PILER-CR matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 11, identity: 0.725 

catggcgtagaaaaaagaaattttcaatattgttttatgg-	CRISPR spacer
aacacaatagaaaaaagaaattttcaaccttg-tttatact	Protospacer
 *..  .********************. *** *****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 790348 : 851791 44 Acinetobacter_phage(28.57%) transposase,protease NA
DBSCAN-SWA_2 1137170 : 1144310 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 1217043 : 1223869 9 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_4 1358434 : 1404046 55 Escherichia_phage(56.0%) holin,terminase,integrase,tail attL 1351487:1351504|attR 1382700:1382717
DBSCAN-SWA_5 1772073 : 1781518 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 1871453 : 1877765 6 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_7 2626176 : 2693273 80 Escherichia_phage(39.66%) head,protease,tail,terminase,capsid,lysis,integrase,holin attL 2640286:2640311|attR 2693412:2693437
DBSCAN-SWA_8 2797773 : 2840373 38 Enterobacteria_phage(58.33%) transposase,lysis,tRNA,tail NA
DBSCAN-SWA_9 2844475 : 2882030 50 Escherichia_phage(42.5%) head,portal,tail,terminase,capsid,lysis,integrase,holin attL 2835257:2835271|attR 2882686:2882700

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage