Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022900 Staphylococcus aureus strain 468 chromosome, complete genome 10 crisprs csa3,cas3,DEDDh,DinG,WYL 5 0 13 0

Results visualization

1. NZ_CP022900
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_1 806580-806664 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_2 864984-865063 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_3 914104-914189 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_4 1215354-1215446 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_5 1938258-1938385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_6 2021569-2021760 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_7 2088350-2088438 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_8 2238137-2238338 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_9 2296670-2296795 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022900_10 2336677-2336757 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022900_1 1.1|806606|33|NZ_CP022900|CRISPRCasFinder 806606-806638 33 NZ_CP022900.1 1039941-1039973 1 0.97
NZ_CP022900_1 1.1|806606|33|NZ_CP022900|CRISPRCasFinder 806606-806638 33 NZ_CP022900.1 2372003-2372035 1 0.97
NZ_CP022900_10 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder 2336702-2336732 31 NZ_CP022900.1 1066219-1066249 1 0.968
NZ_CP022900_10 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder 2336702-2336732 31 NZ_CP022900.1 1640329-1640359 1 0.968
NZ_CP022900_3 3.1|914134|26|NZ_CP022900|CRISPRCasFinder 914134-914159 26 NZ_CP022900.1 2112391-2112416 2 0.923
NZ_CP022900_3 3.1|914134|26|NZ_CP022900|CRISPRCasFinder 914134-914159 26 NZ_CP022900.1 2172475-2172500 2 0.923
NZ_CP022900_6 6.1|2021590|37|NZ_CP022900|CRT 2021590-2021626 37 NZ_CP022900.1 819872-819908 2 0.946
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 257684-257717 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 334357-334390 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 773441-773474 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 806645-806678 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 1066156-1066189 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 1760241-1760274 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 2336641-2336674 2 0.941
NZ_CP022900_6 6.2|2021648|34|NZ_CP022900|CRT 2021648-2021681 34 NZ_CP022900.1 2479635-2479668 2 0.941
NZ_CP022900_10 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder 2336702-2336732 31 NZ_CP022900.1 819996-820026 2 0.935
NZ_CP022900_10 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder 2336702-2336732 31 NZ_CP022900.1 869265-869295 2 0.935
NZ_CP022900_10 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder 2336702-2336732 31 NZ_CP022900.1 914095-914125 2 0.935
NZ_CP022900_10 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder 2336702-2336732 31 NZ_CP022900.1 2011032-2011062 2 0.935

1. spacer 1.1|806606|33|NZ_CP022900|CRISPRCasFinder matches to position: 1039941-1039973, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctgtgttggggccca	Protospacer
******************** ************

2. spacer 1.1|806606|33|NZ_CP022900|CRISPRCasFinder matches to position: 2372003-2372035, mismatch: 1, identity: 0.97

attgggaatccaatttctctttgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttgggaccca	Protospacer
****************************.****

3. spacer 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder matches to position: 1066219-1066249, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

4. spacer 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder matches to position: 1640329-1640359, mismatch: 1, identity: 0.968

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**************************** **

5. spacer 3.1|914134|26|NZ_CP022900|CRISPRCasFinder matches to position: 2112391-2112416, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cgcggccccaacacagaagctggcgg	Protospacer
** ********************.**

6. spacer 3.1|914134|26|NZ_CP022900|CRISPRCasFinder matches to position: 2172475-2172500, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggtgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
***************.*******.**

7. spacer 6.1|2021590|37|NZ_CP022900|CRT matches to position: 819872-819908, mismatch: 2, identity: 0.946

ccaacttgcacattattgtaagctgacagaaagtcag	CRISPR spacer
ccaacttgcacattattgtaagctggcggaaagtcag	Protospacer
*************************.*.*********

8. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 257684-257717, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

9. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 334357-334390, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

10. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 773441-773474, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtttgtagaatttcttttcgaaat	Protospacer
************.***********.*********

11. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 806645-806678, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

12. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 1066156-1066189, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgcctgtagaatttcttttcgaaat	Protospacer
***********.************.*********

13. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 1760241-1760274, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

14. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 2336641-2336674, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

15. spacer 6.2|2021648|34|NZ_CP022900|CRT matches to position: 2479635-2479668, mismatch: 2, identity: 0.941

aacttgcattgtctgtagaatttcctttcgaaat	CRISPR spacer
aacttgcattgtctgtagaatttctttttgaaat	Protospacer
************************.***.*****

16. spacer 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder matches to position: 819996-820026, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgactttacgtcagct	Protospacer
********************** ***** **

17. spacer 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder matches to position: 869265-869295, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctggcttttcgtcagct	Protospacer
*****************.********** **

18. spacer 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder matches to position: 914095-914125, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattattgtaagctgacttttcgccagct	Protospacer
*************************.** **

19. spacer 10.1|2336702|31|NZ_CP022900|CRISPRCasFinder matches to position: 2011032-2011062, mismatch: 2, identity: 0.935

cacattattgtaagctgacttttcgtcacct	CRISPR spacer
cacattatcgtaagctgacttttcgtcagct	Protospacer
********.******************* **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 216589 : 287294 58 Staphylococcus_virus(20.0%) holin,transposase,protease NA
DBSCAN-SWA_2 357866 : 373796 25 Staphylococcus_phage(90.0%) coat,terminase,integrase attL 359402:359419|attR 374503:374520
DBSCAN-SWA_3 666747 : 717744 48 Staphylococcus_phage(28.57%) bacteriocin,transposase NA
DBSCAN-SWA_4 751822 : 759642 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_5 771614 : 785752 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 955719 : 1004543 44 Bacillus_virus(22.22%) tRNA,transposase,protease,holin NA
DBSCAN-SWA_7 1041469 : 1049942 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 1287914 : 1330555 42 Staphylococcus_phage(40.0%) tRNA,transposase,capsid NA
DBSCAN-SWA_9 1611949 : 1620261 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_10 1689697 : 1698740 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_11 1828468 : 1897375 64 Staphylococcus_phage(93.02%) tRNA,protease NA
DBSCAN-SWA_12 1932348 : 2000892 81 Staphylococcus_phage(83.33%) tRNA,holin,protease,terminase,portal,tail,head,integrase,capsid attL 1969732:1969746|attR 2002449:2002463
DBSCAN-SWA_13 2078076 : 2092410 22 Staphylococcus_phage(68.42%) integrase,terminase,coat attL 2075708:2075727|attR 2090432:2090451
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage