Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031371 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031374 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvOXA-48, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031370 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 1 crisprs c2c9_V-U4,DinG,RT 1 2 13 0
NZ_CP031375 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_7, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 0 crisprs csa3,cas3 0 0 1 0
NZ_CP031368 Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome 3 crisprs DEDDh,cas3,RT,csa3,DinG,WYL 0 1 5 0
NZ_CP031373 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_6, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP031368
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031368_1 157644-157745 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031368_2 2053676-2053771 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031368_3 4566026-4566134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031368_2 2.1|2053706|36|NZ_CP031368|CRISPRCasFinder 2053706-2053741 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP031368_2 2.1|2053706|36|NZ_CP031368|CRISPRCasFinder 2053706-2053741 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP031368_2 2.1|2053706|36|NZ_CP031368|CRISPRCasFinder 2053706-2053741 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|2053706|36|NZ_CP031368|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 2.1|2053706|36|NZ_CP031368|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 2.1|2053706|36|NZ_CP031368|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 779837 : 790724 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_2 1499784 : 1509258 8 Brazilian_cedratvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_3 2019027 : 2066174 70 Cronobacter_phage(25.0%) tRNA,terminase,holin,head,integrase attL 2015981:2016026|attR 2063246:2063291
DBSCAN-SWA_4 4715063 : 4760605 56 Salmonella_phage(45.45%) holin,integrase,terminase,tail attL 4707469:4707484|attR 4759121:4759136
DBSCAN-SWA_5 5294571 : 5428639 151 Enterobacteria_phage(22.58%) protease,plate,terminase,holin,tRNA,tail,head,portal,integrase,capsid attL 5347334:5347352|attR 5385081:5385099
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP031372
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031372_1 145404-145555 Orphan NA
2 spacers
DinG,RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031369.1 88488-88518 0 1.0

1. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to position: 88488-88518, mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 53730-53760 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252314-252344 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 326007-326037 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 159085-159115 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 228104-228134 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136822-136852 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62819-62849 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 333218-333248 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230175-230205 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 28946-28976 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115908-115938 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11581-11611 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4253-4283 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42565-42595 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145434-145464 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54143-54173 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57670-57700 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28861-28891 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114556-114586 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223544-223574 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 10901-10931 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 299971-300001 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7674-7704 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 313337-313367 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 114284-114314 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP018339 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence 75442-75472 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 279252-279282 0 1.0
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 59354-59384 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 96505-96535 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028554 Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence 39061-39091 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 65428-65458 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 179791-179821 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 21212-21242 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 61178-61208 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 97631-97661 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 76180-76210 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 101929-101959 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY399973 Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence 55596-55626 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY399972 Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence 55596-55626 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 66376-66406 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 81005-81035 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 52695-52725 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 140031-140061 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 45603-45633 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 34474-34504 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 55115-55145 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 77435-77465 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 75721-75751 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 32133-32163 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 77436-77466 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 84718-84748 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KP868646 Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence 55597-55627 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 66174-66204 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 18777-18807 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 50078-50108 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 58203-58233 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 34007-34037 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 24109-24139 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034040 Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence 30989-31019 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 83828-83858 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 128492-128522 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 56304-56334 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 4691-4721 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 93469-93499 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 10720-10750 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 101958-101988 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 109826-109856 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 108233-108263 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 155308-155338 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023418 Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence 102541-102571 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 143237-143267 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 75077-75107 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 114094-114124 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 50772-50802 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 81247-81277 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 181190-181220 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 36302-36332 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 213546-213576 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 98690-98720 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 163407-163437 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 127810-127840 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 4112-4142 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 29182-29212 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 127584-127614 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 59691-59721 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 263676-263706 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 96338-96368 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 62333-62363 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 102629-102659 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 199142-199172 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 107347-107377 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 2294-2324 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 118954-118984 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 41320-41350 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 123953-123983 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 124362-124392 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 123120-123150 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 65234-65264 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 80581-80611 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 74206-74236 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 131300-131330 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 116703-116733 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 186112-186142 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 87236-87266 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 19952-19982 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 135285-135315 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 69471-69501 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 77436-77466 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 252374-252404 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 22124-22154 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 326068-326098 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 326188-326218 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 109037-109067 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 105762-105792 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 12759-12789 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 99836-99866 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 119239-119269 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 48881-48911 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 59322-59352 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 92907-92937 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 7113-7143 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 32679-32709 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 144333-144363 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 76035-76065 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 110777-110807 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 105932-105962 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 90744-90774 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 106327-106357 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 19695-19725 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 128492-128522 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 62396-62426 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 78262-78292 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 213606-213636 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 27026-27056 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 81245-81275 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 245509-245539 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 77867-77897 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 17203-17233 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 126717-126747 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 77436-77466 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 31833-31863 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 128784-128814 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 36167-36197 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 87598-87628 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 31064-31094 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 27327-27357 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 29183-29213 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028791 Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence 30722-30752 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 30101-30131 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 56744-56774 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 95838-95868 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 84715-84745 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 157962-157992 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 55479-55509 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 91109-91139 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 29684-29714 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 119281-119311 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 9345-9375 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 60721-60751 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 139156-139186 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 107505-107535 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 228165-228195 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 228286-228316 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026173 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence 10187-10217 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 59538-59568 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 22819-22849 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 66634-66664 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 51776-51806 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 14111-14141 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 76780-76810 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 81247-81277 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 115292-115322 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 67226-67256 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 111777-111807 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 26047-26077 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 120118-120148 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 338936-338966 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 52094-52124 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 48883-48913 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 102166-102196 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 37974-38004 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 222007-222037 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 98681-98711 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 50332-50362 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 51685-51715 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 64750-64780 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 105877-105907 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 137838-137868 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 62477-62507 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 122943-122973 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 81247-81277 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 157231-157261 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 16643-16673 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP046945 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed6 4735-4765 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 105141-105171 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 167830-167860 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 206178-206208 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 30522-30552 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 62940-62970 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 60134-60164 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 158530-158560 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 124269-124299 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 27045-27075 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 47182-47212 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 60675-60705 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 61246-61276 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 23497-23527 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 83500-83530 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 2198-2228 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 29182-29212 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 136883-136913 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 75952-75982 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 30101-30131 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 56743-56773 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 62880-62910 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 93475-93505 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 158842-158872 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 167873-167903 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 333279-333309 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 107511-107541 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 39284-39314 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 70558-70588 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 182495-182525 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 122507-122537 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 230236-230266 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 100045-100075 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 29007-29037 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 93768-93798 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 115969-115999 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 116090-116120 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 146920-146950 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 28935-28965 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 53245-53275 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 61497-61527 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 87956-87986 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 140602-140632 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 216323-216353 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 133447-133477 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 104865-104895 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026148 Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence 30717-30747 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 132468-132498 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 265812-265842 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 50532-50562 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 150284-150314 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 11642-11672 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 140116-140146 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 152970-153000 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 11059-11089 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 107603-107633 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 116393-116423 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 139034-139064 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 80019-80049 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 90585-90615 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 114510-114540 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 123066-123096 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 30934-30964 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 112730-112760 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 178127-178157 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 70046-70076 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 4314-4344 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 83741-83771 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 81460-81490 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024507 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence 42626-42656 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024509 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence 104360-104390 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 62220-62250 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 6685-6715 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 70887-70917 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 6357-6387 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 6829-6859 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 203143-203173 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 111261-111291 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 54954-54984 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 110238-110268 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 29565-29595 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 61232-61262 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 291431-291461 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 168956-168986 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 97353-97383 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 104308-104338 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 127650-127680 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 125841-125871 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 21722-21752 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 94410-94440 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 24115-24145 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 26156-26186 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044378 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence 112487-112517 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044382 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence 85774-85804 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 110113-110143 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 102991-103021 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 179739-179769 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 136858-136888 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 88488-88518 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 145495-145525 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 31445-31475 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 75514-75544 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 29627-29657 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 81250-81280 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 72755-72785 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 34137-34167 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 38715-38745 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 45137-45167 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 127583-127613 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 52052-52082 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 4815-4845 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 94354-94384 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 28709-28739 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 31695-31725 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 127584-127614 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 81230-81260 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 83511-83541 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 81248-81278 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 34007-34037 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 106993-107023 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 172345-172375 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 125121-125151 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 127584-127614 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 81248-81278 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 14354-14384 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 141894-141924 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 47006-47036 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 50078-50108 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 116989-117019 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 127584-127614 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 19696-19726 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 139496-139526 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 45353-45383 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 88073-88103 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 54204-54234 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 142479-142509 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 148053-148083 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 74167-74197 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 34828-34858 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 59321-59351 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 139323-139353 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 272507-272537 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 85046-85076 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 86274-86304 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 115774-115804 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 53119-53149 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MH255827 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence 34082-34112 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 70460-70490 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 31029-31059 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MH192342 Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence 56880-56910 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 120894-120924 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 62695-62725 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 159888-159918 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 90472-90502 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 166064-166094 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 97242-97272 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP014776 Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence 57731-57761 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 24452-24482 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 129279-129309 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 146421-146451 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 83871-83901 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 157062-157092 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 52737-52767 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 192365-192395 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 108852-108882 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 76525-76555 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 28922-28952 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 170669-170699 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 68187-68217 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 40841-40871 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 128613-128643 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034407 Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence 40663-40693 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 153716-153746 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 83467-83497 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 50499-50529 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 176138-176168 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MT108209 Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence 61227-61257 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 29658-29688 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 65894-65924 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 109106-109136 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 14695-14725 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 10362-10392 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 186201-186231 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 109535-109565 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 49663-49693 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 57897-57927 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 277250-277280 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 19474-19504 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 114125-114155 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 128539-128569 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 101438-101468 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 103544-103574 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 56931-56961 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 72432-72462 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 176973-177003 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 59884-59914 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 158468-158498 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 86345-86375 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 117214-117244 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 209372-209402 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 66656-66686 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 210408-210438 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 71338-71368 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020359 Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence 109889-109919 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 116366-116396 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 178244-178274 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 91300-91330 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 120741-120771 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 137324-137354 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 72489-72519 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 208437-208467 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 184580-184610 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 65955-65985 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 51967-51997 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008789 Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence 93577-93607 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 155366-155396 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 100384-100414 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 149195-149225 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 102249-102279 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 58450-58480 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 170800-170830 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 179136-179166 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 208328-208358 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 108358-108388 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 150546-150576 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 9714-9744 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 95919-95949 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 135263-135293 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 147535-147565 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 371987-372017 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 76077-76107 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 106688-106718 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 120183-120213 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 119276-119306 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 150949-150979 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 8355-8385 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 100346-100376 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 239113-239143 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 148111-148141 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 57702-57732 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 59886-59916 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 104697-104727 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 164035-164065 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 141467-141497 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 39834-39864 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 114495-114525 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 176271-176301 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 105025-105055 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 73865-73895 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 223483-223513 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 11035-11065 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 148667-148697 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 166900-166930 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 127067-127097 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 8815-8845 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 85927-85957 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 51524-51554 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 241681-241711 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 64485-64515 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 155910-155940 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 138634-138664 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 139093-139123 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 163477-163507 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 23798-23828 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 138109-138139 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 49937-49967 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 175771-175801 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 86024-86054 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 73873-73903 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 57893-57923 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 246501-246531 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 84684-84714 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 19819-19849 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 94919-94949 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 141761-141791 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033823 Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence 119263-119293 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 82882-82912 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 130170-130200 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 75867-75897 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 84876-84906 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 192186-192216 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 177875-177905 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 149195-149225 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 99223-99253 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 134967-134997 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 133111-133141 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 83306-83336 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 118746-118776 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 213701-213731 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 202896-202926 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 315820-315850 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 22182-22212 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 121236-121266 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 151055-151085 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 99550-99580 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 219675-219705 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 75784-75814 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 110052-110082 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 51744-51774 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 32840-32870 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 144399-144429 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 148338-148368 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 13735-13765 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 86585-86615 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 114244-114274 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 203673-203703 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 144126-144156 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 207286-207316 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 124312-124342 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 58090-58120 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 85307-85337 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 108302-108332 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 161690-161720 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 85975-86005 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 10719-10749 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 10840-10870 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP031793 Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence 110068-110098 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP032181 Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence 67295-67325 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 73746-73776 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 299910-299940 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 138945-138975 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 102548-102578 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 52078-52108 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7492-7522 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 7613-7643 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 47583-47613 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 71171-71201 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 189515-189545 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 97307-97337 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020064 Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence 53510-53540 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 137756-137786 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 167918-167948 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP038275 Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence 77591-77621 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP038276 Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence 107045-107075 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 41397-41427 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 116353-116383 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 201935-201965 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP028930 Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence 41268-41298 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 121998-122028 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP050168 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence 87881-87911 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 131702-131732 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 151321-151351 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP016922 Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence 23197-23227 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 207131-207161 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 153395-153425 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 175619-175649 0 1.0
NZ_CP031372_1 1.2|145495|31|NZ_CP031372|PILER-CR 145495-145525 31 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 159146-159176 5 0.839
NZ_CP031372_1 1.1|145434|31|NZ_CP031372|PILER-CR 145434-145464 31 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 80225-80255 6 0.806

1. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

2. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

3. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

4. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

5. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

6. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

7. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

8. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

9. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

10. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

11. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

12. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

13. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

14. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

15. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

16. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

17. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

18. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

19. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

20. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

21. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

22. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

23. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

24. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

25. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

26. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP018339 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

27. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

28. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
gctggatttccgtcagttggtcagctgctgc	Protospacer
*******************************

29. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

30. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

31. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

32. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

33. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

34. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

35. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

36. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

37. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

38. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

39. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

40. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

41. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

42. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

43. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

44. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

45. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

46. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

47. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

48. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

49. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

50. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

51. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

52. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

53. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

54. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

55. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

56. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

57. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

58. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

59. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

60. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

61. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

62. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

63. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

64. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

65. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

66. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

67. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

68. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

69. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

70. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

71. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

72. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

73. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

74. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

75. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

76. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

77. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

78. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

79. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

80. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

81. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

82. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

83. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

84. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

85. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

86. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

87. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

88. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

89. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

90. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

91. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

92. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

93. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

94. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

95. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

96. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

97. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

98. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

99. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

100. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

101. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

102. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

103. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

104. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

105. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

106. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

107. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

108. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

109. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

110. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

111. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

112. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

113. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

114. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

115. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

116. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

117. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

118. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

119. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

120. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

121. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

122. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

123. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

124. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

125. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

126. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

127. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

128. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

129. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

130. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

131. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

132. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

133. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

134. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

135. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

136. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

137. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

138. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

139. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

140. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

141. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

142. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

143. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

144. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

145. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

146. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

147. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

148. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028791 (Klebsiella pneumoniae strain WCHKP020030 plasmid pOXA1_020030, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

149. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

150. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

151. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

152. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

153. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

154. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

155. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

156. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

157. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

158. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

159. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

160. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

161. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

162. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

163. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

164. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

165. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

166. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

167. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

168. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

169. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

170. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

171. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

172. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

173. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

174. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

175. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

176. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

177. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

178. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

179. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

180. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

181. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

182. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

183. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

184. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

185. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

186. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

187. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

188. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

189. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

190. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

191. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

192. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

193. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

194. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP046945 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed6) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

195. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

196. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

197. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

198. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

199. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

200. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

201. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

202. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

203. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

204. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

205. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

206. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

207. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

208. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

209. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

210. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

211. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

212. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

213. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

214. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

215. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

216. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

217. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

218. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

219. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

220. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

221. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

222. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

223. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

224. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

225. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

226. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

227. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

228. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

229. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

230. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

231. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

232. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

233. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

234. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

235. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

236. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

237. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

238. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

239. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

240. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

241. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

242. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

243. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

244. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

245. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

246. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

247. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

248. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

249. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

250. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

251. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

252. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

253. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

254. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

255. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

256. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

257. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

258. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

259. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

260. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

261. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

262. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

263. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

264. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

265. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

266. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

267. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

268. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

269. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

270. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

271. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

272. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

273. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

274. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

275. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

276. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

277. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

278. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

279. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

280. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

281. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

282. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

283. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

284. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

285. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

286. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

287. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

288. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

289. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

290. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

291. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

292. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

293. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

294. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

295. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

296. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

297. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

298. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

299. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

300. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

301. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

302. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

303. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

304. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

305. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

306. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

307. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

308. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

309. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

310. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

311. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

312. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

313. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

314. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

315. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

316. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

317. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

318. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

319. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

320. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

321. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

322. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

323. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

324. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

325. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

326. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

327. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

328. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

329. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

330. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

331. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

332. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

333. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

334. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

335. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

336. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

337. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

338. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

339. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

340. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

341. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

342. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

343. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

344. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

345. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

346. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

347. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

348. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

349. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

350. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP014776 (Pluralibacter gergoviae strain FB2 plasmid pFB2.1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

351. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

352. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

353. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

354. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

355. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

356. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

357. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

358. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

359. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

360. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

361. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

362. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

363. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

364. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

365. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

366. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

367. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

368. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

369. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

370. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

371. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

372. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

373. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

374. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

375. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

376. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

377. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

378. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

379. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

380. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

381. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

382. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

383. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

384. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

385. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

386. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

387. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

388. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

389. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

390. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

391. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

392. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

393. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

394. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

395. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

396. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

397. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

398. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

399. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

400. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

401. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

402. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

403. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

404. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

405. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

406. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

407. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

408. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

409. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

410. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

411. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

412. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

413. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

414. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

415. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

416. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

417. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

418. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

419. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

420. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

421. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

422. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

423. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

424. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

425. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

426. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

427. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

428. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

429. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

430. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

431. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

432. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

433. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

434. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

435. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

436. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

437. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

438. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

439. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

440. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

441. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

442. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

443. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

444. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

445. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

446. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

447. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

448. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

449. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

450. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

451. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

452. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

453. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

454. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

455. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

456. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

457. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

458. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

459. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

460. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

461. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

462. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

463. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

464. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

465. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

466. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

467. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

468. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

469. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

470. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

471. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

472. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

473. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

474. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

475. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

476. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

477. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

478. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

479. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

480. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

481. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

482. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

483. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

484. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

485. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

486. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

487. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

488. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

489. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

490. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

491. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

492. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

493. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

494. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

495. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

496. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

497. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

498. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

499. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

500. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

501. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

502. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

503. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

504. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

505. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

506. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

507. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

508. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

509. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

510. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

511. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP032181 (Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

512. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

513. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

514. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

515. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

516. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

517. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

518. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

519. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

520. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

521. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

522. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

523. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

524. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

525. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

526. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP038275 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-101716, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

527. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP038276 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-107717, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

528. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

529. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

530. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

531. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

532. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

533. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

534. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

535. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

536. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

537. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

538. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

539. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 0, identity: 1.0

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagtggattaa	Protospacer
*******************************

540. spacer 1.2|145495|31|NZ_CP031372|PILER-CR matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 5, identity: 0.839

ttccggactcctgtttccggcagtggattaa	CRISPR spacer
ttccggactcctgtttccggcagggcactgt	Protospacer
*********************** * *.*. 

541. spacer 1.1|145434|31|NZ_CP031372|PILER-CR matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 6, identity: 0.806

gctggatttccgtcagttggtcagctgctgc	CRISPR spacer
tcgggatttccgtcatttgttcagctgccgt	Protospacer
 * ************ *** ********.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4917 2 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_2 11113 : 11998 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_3 21418 : 22663 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_4 30052 : 34832 5 Cafeteria_roenbergensis_virus(25.0%) transposase NA
DBSCAN-SWA_5 75725 : 76973 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_6 90071 : 96886 11 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_7 100938 : 107329 10 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_8 111460 : 114314 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_9 121018 : 135447 22 Salmonella_phage(28.57%) NA NA
DBSCAN-SWA_10 140935 : 142810 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_11 146315 : 149579 4 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_12 157516 : 159429 2 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_13 200544 : 207320 5 Tupanvirus(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP031369
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 123339 : 228344 96 Stx2-converting_phage(11.54%) transposase,bacteriocin,integrase attL 134032:134053|attR 185113:185134
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP031373
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 24456 : 32607 10 Escherichia_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage