Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP012224 Campylobacter jejuni strain CJ066CC508 chromosome, complete genome 2 crisprs DEDDh,WYL,cas2,cas1 0 2 1 0

Results visualization

1. NZ_CP012224
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012224_1 1300896-1300975 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP012224_2 1423381-1423547 Unclear NA
2 spacers
cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP012224_2 2.1|1423416|31|NZ_CP012224|CRISPRCasFinder 1423416-1423446 31 MN530981 Campylobacter phage DA10, complete genome 32318-32348 1 0.968
NZ_CP012224_2 2.1|1423416|31|NZ_CP012224|CRISPRCasFinder 1423416-1423446 31 MT774405 CrAssphage cr115_1, complete genome 65541-65571 7 0.774
NZ_CP012224_1 1.1|1300919|34|NZ_CP012224|CRISPRCasFinder 1300919-1300952 34 MH752385 Bacillus phage Ray17, complete genome 8509-8542 10 0.706

1. spacer 2.1|1423416|31|NZ_CP012224|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.968

ccattagtttttaaagggtgtaagtataacg	CRISPR spacer
ccattagtttttaaagggtgtaagtataact	Protospacer
****************************** 

2. spacer 2.1|1423416|31|NZ_CP012224|CRISPRCasFinder matches to MT774405 (CrAssphage cr115_1, complete genome) position: , mismatch: 7, identity: 0.774

ccattagtttttaaagggtgtaagtataacg	CRISPR spacer
ccataagtttttaaaaggtgtaagtttccat	Protospacer
**** **********.********* *    

3. spacer 1.1|1300919|34|NZ_CP012224|CRISPRCasFinder matches to MH752385 (Bacillus phage Ray17, complete genome) position: , mismatch: 10, identity: 0.706

ttttttagctttatactcagccttactcatataa	CRISPR spacer
cttacaagctttatactcagccttattgatcgtt	Protospacer
.** . *******************.* **    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1323774 : 1334824 14 Acanthocystis_turfacea_Chlorella_virus(20.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage