Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP037927 Klebsiella pneumoniae strain CRKP I chromosome, complete genome 3 crisprs cas3,DEDDh,WYL,DinG,RT,csa3 0 1 11 0

Results visualization

1. NZ_CP037927
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP037927_1 794118-794203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP037927_2 1280591-1280686 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP037927_3 1668953-1669030 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP037927_2 2.1|1280621|36|NZ_CP037927|CRISPRCasFinder 1280621-1280656 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP037927_2 2.1|1280621|36|NZ_CP037927|CRISPRCasFinder 1280621-1280656 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP037927_2 2.1|1280621|36|NZ_CP037927|CRISPRCasFinder 1280621-1280656 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|1280621|36|NZ_CP037927|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 2.1|1280621|36|NZ_CP037927|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 2.1|1280621|36|NZ_CP037927|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 570231 : 577613 8 Enterobacteria_phage(83.33%) transposase NA
DBSCAN-SWA_2 1048355 : 1060012 13 Enterobacteria_phage(70.0%) integrase attL 1036489:1036503|attR 1059549:1059563
DBSCAN-SWA_3 1259741 : 1317040 76 Escherichia_phage(18.87%) protease,transposase,integrase,tRNA,capsid,terminase attL 1272447:1272493|attR 1322850:1322896
DBSCAN-SWA_4 1762522 : 1836538 73 Salmonella_phage(56.82%) protease,plate,integrase,tail,tRNA,capsid,portal,terminase,lysis,head attL 1762430:1762448|attR 1792730:1792748
DBSCAN-SWA_5 2261601 : 2302530 59 uncultured_Caudovirales_phage(32.0%) terminase,transposase,integrase attL 2259682:2259696|attR 2268622:2268636
DBSCAN-SWA_6 2529700 : 2536130 6 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_7 3208121 : 3275724 59 Microcystis_phage(22.22%) protease,tRNA,plate,transposase NA
DBSCAN-SWA_8 3537272 : 3545649 8 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_9 3588976 : 3595882 6 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_10 4001030 : 4075936 75 Escherichia_phage(31.91%) plate,transposase,integrase,tail,tRNA,holin,capsid,portal,terminase,lysis,head attL 4024386:4024401|attR 4043716:4043731
DBSCAN-SWA_11 4767524 : 4816367 55 uncultured_Caudovirales_phage(66.67%) protease,tail,tRNA,capsid,portal,terminase,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage