Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP039434 Enterococcus faecalis strain SGAir0397 chromosome, complete genome 3 crisprs csa3,cas3,cas14j,DinG,DEDDh 0 2 4 0

Results visualization

1. NZ_CP039434
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039434_1 1714375-1714806 Orphan II-A,II-B
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039434_2 1909326-1909446 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP039434_3 2529436-2529509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP039434_1 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714609-1714638 30 CAJDJX010000002 Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence 3784-3813 0 1.0
NZ_CP039434_1 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714609-1714638 30 MK982307 Enterococcus phage MSF2, complete genome 8126-8155 0 1.0
NZ_CP039434_1 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714609-1714638 30 CAJDKF010000002 Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence 4263-4292 0 1.0
NZ_CP039434_1 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714609-1714638 30 MK721190 Enterococcus phage vB_EfaS_Ef6.4, complete genome 2586-2615 1 0.967
NZ_CP039434_1 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714543-1714572 30 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 15061-15090 6 0.8
NZ_CP039434_1 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714543-1714572 30 MH920640 Synechoccus phage S-E7, complete genome 165944-165973 7 0.767
NZ_CP039434_1 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714543-1714572 30 MH920639 Synechoccus phage S-P4, partial genome 163-192 7 0.767
NZ_CP039434_1 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR 1714543-1714572 30 HQ634189 Cyanophage Syn30 genomic sequence 24066-24095 7 0.767

1. spacer 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to CAJDJX010000002 (Enterococcus phage Q69 genome assembly, contig: phageQ69-genome, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

tgcggacatgtgcgactggatagttgattt	CRISPR spacer
tgcggacatgtgcgactggatagttgattt	Protospacer
******************************

2. spacer 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 0, identity: 1.0

tgcggacatgtgcgactggatagttgattt	CRISPR spacer
tgcggacatgtgcgactggatagttgattt	Protospacer
******************************

3. spacer 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to CAJDKF010000002 (Enterococcus phage vB_EfaS_159 genome assembly, contig: phage159-genome, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

tgcggacatgtgcgactggatagttgattt	CRISPR spacer
tgcggacatgtgcgactggatagttgattt	Protospacer
******************************

4. spacer 1.4|1714609|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to MK721190 (Enterococcus phage vB_EfaS_Ef6.4, complete genome) position: , mismatch: 1, identity: 0.967

tgcggacatgtgcgactggatagttgattt	CRISPR spacer
tgcggatatgtgcgactggatagttgattt	Protospacer
******.***********************

5. spacer 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.8

gcttcaggtgtcttcacaactgcttttgat	CRISPR spacer
gattcaagtgtcttcacatctgcttcggac	Protospacer
* ****.*********** ******. **.

6. spacer 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to MH920640 (Synechoccus phage S-E7, complete genome) position: , mismatch: 7, identity: 0.767

gcttcaggtgtcttcacaactgcttttgat	CRISPR spacer
tattcaggtgtcttcactaatgcttggaat	Protospacer
  *************** * *****  .**

7. spacer 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to MH920639 (Synechoccus phage S-P4, partial genome) position: , mismatch: 7, identity: 0.767

gcttcaggtgtcttcacaactgcttttgat	CRISPR spacer
tattcaggtgtcttcactaatgcttggaat	Protospacer
  *************** * *****  .**

8. spacer 1.3|1714543|30|NZ_CP039434|CRISPRCasFinder,CRT,PILER-CR matches to HQ634189 (Cyanophage Syn30 genomic sequence) position: , mismatch: 7, identity: 0.767

gcttcaggtgtcttcacaactgcttttgat	CRISPR spacer
tattcaggtgtcttcactaatgcttggaat	Protospacer
  *************** * *****  .**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 675769 : 683689 12 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_2 869748 : 905704 45 Enterococcus_phage(28.12%) holin,tail,portal,capsid,terminase,head,integrase,protease attL 868084:868101|attR 909111:909128
DBSCAN-SWA_3 1079940 : 1097672 21 Enterococcus_phage(42.86%) holin,tail NA
DBSCAN-SWA_4 1527524 : 1536168 9 Synechococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage