Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027295 Brachybacterium sp. SGAir0954 chromosome, complete genome 1 crisprs DEDDh,csa3,WYL,cas3,DinG 0 1 0 0

Results visualization

1. NZ_CP027295
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027295_1 3189303-3189380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027295_1 1.1|3189327|30|NZ_CP027295|CRISPRCasFinder 3189327-3189356 30 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 344142-344171 7 0.767

1. spacer 1.1|3189327|30|NZ_CP027295|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.767

cttcttcttcgaggaggacttcttctcgct	CRISPR spacer
gttcaaggtcgagcaggacttcttctcgcg	Protospacer
 ***    ***** *************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage