Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027298 Streptomyces sp. SGAir0924 plasmid unnamed_4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 0 crisprs NA 0 0 0 0
NZ_CP027297 Streptomyces sp. SGAir0924 chromosome, complete genome 2 crisprs csa3,WYL,casR,DEDDh,cas4,Cas9_archaeal,cas3,DinG 0 1 3 0
NZ_CP027296 Streptomyces sp. SGAir0924 plasmid unnamed_1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP027297
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027297_1 2197568-2197661 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027297_2 2693511-2693601 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027297_2 2.1|2693542|29|NZ_CP027297|CRISPRCasFinder 2693542-2693570 29 NZ_CP021796 Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence 29290-29318 7 0.759

1. spacer 2.1|2693542|29|NZ_CP027297|CRISPRCasFinder matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.759

gcgggagttcaggatgtcgatccagagca	CRISPR spacer
ctccgcgttcaggatctcgatccagagct	Protospacer
 .  * ********* ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3763854 : 3812176 46 Bacillus_phage(37.5%) plate,tail,transposase,tRNA NA
DBSCAN-SWA_2 5738820 : 5752262 15 Streptomyces_phage(80.0%) NA NA
DBSCAN-SWA_3 5779154 : 5787517 13 Streptomyces_phage(55.56%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage