Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040007 Pseudopropionibacterium propionicum strain F0700 chromosome, complete genome 10 crisprs csa3,csm3gr7,cas10,cas6,cas3,cas2,cas1,cas8u1,csb2gr5,csb1gr7,DEDDh,DinG,WYL,PD-DExK,cas7 2 3 0 0

Results visualization

1. NZ_CP040007
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_1 215983-216077 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_2 335373-335467 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_3 363279-363372 Unclear NA
1 spacers
cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_4 453762-453845 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_5 650351-651910 Unclear NA
21 spacers
cas2,cas1,cas8u1,cas3,csb2gr5,csb1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_6 692905-693015 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_7 2424748-2424851 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_8 2866540-2866631 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_9 2946744-2953888 TypeI-A NA
97 spacers
csa3,cas2,cas1,csb2gr5,cas7,cas8u1,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040007_10 3332400-3332484 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP040007_6 6.1|692943|35|NZ_CP040007|CRISPRCasFinder 692943-692977 35 NZ_CP040007.1 700957-700991 0 1.0
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP040007.1 2749284-2749313 2 0.933
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP040007.1 3002515-3002544 2 0.933
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP040007.1 3002782-3002811 2 0.933

1. spacer 6.1|692943|35|NZ_CP040007|CRISPRCasFinder matches to position: 700957-700991, mismatch: 0, identity: 1.0

tcgagaccgccatcaaggtggcccgcaagtggggg	CRISPR spacer
tcgagaccgccatcaaggtggcccgcaagtggggg	Protospacer
***********************************

2. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to position: 2749284-2749313, mismatch: 2, identity: 0.933

accagctggttgagccgggctgcgatgaag	CRISPR spacer
acaagctggttgagccgggctgcgacgaag	Protospacer
** **********************.****

3. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to position: 3002515-3002544, mismatch: 2, identity: 0.933

accagctggttgagccgggctgcgatgaag	CRISPR spacer
acaagctggttgagccgggctgcgacgaag	Protospacer
** **********************.****

4. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to position: 3002782-3002811, mismatch: 2, identity: 0.933

accagctggttgagccgggctgcgatgaag	CRISPR spacer
acaagctggttgagccgggctgcgacgaag	Protospacer
** **********************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 572964-572993 7 0.767
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 573007-573036 7 0.767
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 573007-573036 7 0.767
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 572998-573027 7 0.767
NZ_CP040007_4 4.1|453789|30|NZ_CP040007|CRISPRCasFinder 453789-453818 30 NZ_CP013125 Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence 112152-112181 8 0.733
NZ_CP040007_5 5.1|650387|37|NZ_CP040007|PILER-CR,CRISPRCasFinder,CRT 650387-650423 37 NZ_CP018235 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence 96065-96101 10 0.73
NZ_CP040007_5 5.1|650387|37|NZ_CP040007|PILER-CR,CRISPRCasFinder,CRT 650387-650423 37 NZ_CP016290 Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence 268793-268829 10 0.73
NZ_CP040007_9 9.86|2953014|34|NZ_CP040007|CRISPRCasFinder,CRT,PILER-CR 2953014-2953047 34 NC_022980 Brevibacillus phage Davies, complete genome 28315-28348 10 0.706

1. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

accagctggttgagccgggctgcgatgaag	CRISPR spacer
gcgagccggttgagccgggcggcgatggcc	Protospacer
.* ***.************* ******.  

2. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

accagctggttgagccgggctgcgatgaag	CRISPR spacer
gcgagccggttgagccgggcggcgatggcc	Protospacer
.* ***.************* ******.  

3. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

accagctggttgagccgggctgcgatgaag	CRISPR spacer
gcgagccggttgagccgggcggcgatggcc	Protospacer
.* ***.************* ******.  

4. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

accagctggttgagccgggctgcgatgaag	CRISPR spacer
gcgagccggttgagccgggcggcgatggcc	Protospacer
.* ***.************* ******.  

5. spacer 4.1|453789|30|NZ_CP040007|CRISPRCasFinder matches to NZ_CP013125 (Pseudomonas mendocina S5.2 plasmid pPME5, complete sequence) position: , mismatch: 8, identity: 0.733

accagctggttgagccgggctgcgatgaag	CRISPR spacer
ttgatgaggttgagccgggcggtgatgaag	Protospacer
 . *   ************* *.*******

6. spacer 5.1|650387|37|NZ_CP040007|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018235 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.73

ccttccaacccggcgccgtcctcgaggccgcccacct	CRISPR spacer
gcctcatcaacggcgccgtcctcgatgccgccgaccg	Protospacer
 *.**     *************** ****** *** 

7. spacer 5.1|650387|37|NZ_CP040007|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016290 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.73

ccttccaacccggcgccgtcctcgaggccgcccacct	CRISPR spacer
gcctcatcaacggcgccgtcctcgatgccgccgaccg	Protospacer
 *.**     *************** ****** *** 

8. spacer 9.86|2953014|34|NZ_CP040007|CRISPRCasFinder,CRT,PILER-CR matches to NC_022980 (Brevibacillus phage Davies, complete genome) position: , mismatch: 10, identity: 0.706

acacccaaccgtcacgcaacaggcgcgacagtat	CRISPR spacer
ggatgaaaccgtcaggcaacaggagcgacaggtc	Protospacer
. *.  ******** ******** *******  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage