Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035541 Staphylococcus haemolyticus strain PK-01 chromosome, complete genome 2 crisprs csa3,WYL,DEDDh,cas3,DinG 0 1 10 1

Results visualization

1. NZ_CP035541
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035541_1 1981597-1981683 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035541_2 2292600-2292689 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035541_1 1.1|1981627|27|NZ_CP035541|CRISPRCasFinder 1981627-1981653 27 MN693238 Marine virus AFVG_25M402, complete genome 24675-24701 6 0.778

1. spacer 1.1|1981627|27|NZ_CP035541|CRISPRCasFinder matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 6, identity: 0.778

ccccaaccccagcctgctttgcttgtg	CRISPR spacer
taagaatcccagcctgcgttgcttgtg	Protospacer
.   **.********** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 83823 : 148641 57 Staphylococcus_phage(58.82%) protease,transposase NA
DBSCAN-SWA_2 1100709 : 1155652 54 Staphylococcus_phage(56.82%) tRNA,integrase attL 1106326:1106342|attR 1148456:1148472
DBSCAN-SWA_3 1413843 : 1423698 11 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_4 1739402 : 1808734 91 Staphylococcus_phage(81.54%) capsid,head,terminase,tail,holin,tRNA,portal,plate,integrase attL 1794724:1794740|attR 1814106:1814122
DBSCAN-SWA_5 1889341 : 1897811 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2065827 : 2081832 22 uncultured_Caudovirales_phage(44.44%) terminase,integrase attL 2060731:2060751|attR 2078263:2078283
DBSCAN-SWA_7 2133630 : 2147799 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_8 2162602 : 2169839 8 Pandoravirus(14.29%) NA NA
DBSCAN-SWA_9 2456758 : 2462515 8 uncultured_Caudovirales_phage(83.33%) terminase,integrase attL 2459391:2459406|attR 2472598:2472613
DBSCAN-SWA_10 2530383 : 2579265 42 Staphylococcus_phage(46.15%) transposase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP035541.1|WP_117276929.1|1762722_1763055_-|hypothetical-protein 1762722_1763055_- 110 aa aa 66 NA NA 1739402-1808734 NA