1. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 5, identity: 0.821
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
tggcggcggtctccgtcgggatgcgggt Protospacer
**********.******* **** **
2. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to MN106244 (Klebsiella phage Soft, complete genome) position: , mismatch: 5, identity: 0.821
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
cgtcagcggtatccgacgcgatgaccgt Protospacer
.* *.***** **** ************
3. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.786
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
gggcggcgattgccgtcgcgatgatccc Protospacer
*******.** ************.* .
4. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to MH697592 (Mycobacterium phage Rando14, complete genome) position: , mismatch: 6, identity: 0.786
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
tggcggccgttgccgtcgcgatggtggc Protospacer
******* *** ***********.. *.
5. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.824
cggcggggatcggccgcgccgcgat---gagcgtgca CRISPR spacer
cggcggggatcgcccgcgccgcgacagagagcct--- Protospacer
************ ***********. **** *
6. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.75
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
tggcggcggtttccggcgtgatgcgttc Protospacer
*************** **.**** . .
7. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 7, identity: 0.75
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
accacgcgggttccgtcgcgatgaccat Protospacer
**** ****************.*
8. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
gcaaggcggttttcgtcgcggtgaccgg Protospacer
. ********.*******.******
9. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.75
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
tggcggcggtttccggcgtgatgcgttc Protospacer
*************** **.**** . .
10. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 7, identity: 0.75
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
accacgcgggttccgtcgcgatgaccat Protospacer
**** ****************.*
11. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 7, identity: 0.75
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
tggcggcggtttccggcgtgatgcgttc Protospacer
*************** **.**** . .
12. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP014302 (Bosea sp. PAMC 26642 strain PAMC26642 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
ggatgcagaccggccgcgccgcgatgagcctgca Protospacer
*..* .**.******************* ****
13. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP014302 (Bosea sp. PAMC 26642 strain PAMC26642 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
ggatgcagaccggccgcgccgcgatgagcctgca Protospacer
*..* .**.******************* ****
14. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.714
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
gggcgacggtttccgtcgcgatcgaaaa Protospacer
****.**************** . .
15. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 8, identity: 0.714
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
gggcgacggtttccgtcgcgatcgagaa Protospacer
****.**************** . .
16. spacer 2.2|1318422|28|NZ_CP039424|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 8, identity: 0.714
tggcggcggtttccgtcgcgatgaccgt CRISPR spacer
gggcgacggtttccgtcgcgatcgagaa Protospacer
****.**************** . .
17. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
cggcggtgatcggccgcgacgcgatcgccatcga Protospacer
****** *********** ****** . *.* *
18. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
cggcggtgatcggccgcgacgcgatcgccatcga Protospacer
****** *********** ****** . *.* *
19. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.765
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
cggcggtgatcggccgcgacgcgatcgccatcga Protospacer
****** *********** ****** . *.* *
20. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.735
cggcggg-gatcggccgcgccgcgatgagcgtgca CRISPR spacer
-aacgagcgatcggcggcgccgcgatgatcgtcgt Protospacer
..**.* ******* ************ ***
21. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
gcgtgaggatcggccgagccgcgacgagcgcccg Protospacer
*.*.********** *******.*****. *.
22. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.735
cggcggg-gatcggccgcgccgcgatgagcgtgca CRISPR spacer
-aacgagcgatcggcggcgccgcgatgatcgtcgt Protospacer
..**.* ******* ************ ***
23. spacer 2.3|1318476|34|NZ_CP039424|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.735
cggcggggatcggccgcgccgcgatgagcgtgca CRISPR spacer
gcgtgaggatcggccgagccgcgacgagcgcccg Protospacer
*.*.********** *******.*****. *.
24. spacer 2.4|1318536|34|NZ_CP039424|CRISPRCasFinder matches to MF098556 (Hot spring virus BHS1, partial genome) position: , mismatch: 10, identity: 0.706
tggcgccggtgacttccgtcgtggcgatcgccgt CRISPR spacer
ccgcgcgcgtgacttccgtcgtggcgattatttc Protospacer
. **** ********************.... .
25. spacer 2.4|1318536|34|NZ_CP039424|CRISPRCasFinder matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 10, identity: 0.706
tggcgccggtgacttccgtcgtggcgatcgccgt CRISPR spacer
tggcgccggtgacttcggtcttggccggcatgtc Protospacer
**************** *** **** . *.. .