Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040567 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 plasmid pCFSAN059543, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP040566 Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 chromosome, complete genome 5 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas14j,DEDDh,DinG,RT 0 9 10 0

Results visualization

1. NZ_CP040567
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 62214 80 Salmonella_phage(94.59%) tail,terminase NA
DBSCAN-SWA_2 66873 : 105206 46 Salmonella_phage(90.24%) integrase attL 62784:62799|attR 74886:74901

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP040566
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040566_1 599122-599222 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040566_2 948204-948476 TypeI-E I-E
4 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040566_3 964608-965066 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040566_4 965140-965717 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040566_5 1156654-1156763 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040566_3 3.11|964882|32|NZ_CP040566|CRISPRCasFinder,CRT 964882-964913 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
NZ_CP040566_3 3.11|964882|32|NZ_CP040566|CRISPRCasFinder,CRT 964882-964913 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
NZ_CP040566_4 4.1|965169|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 965169-965200 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
NZ_CP040566_4 4.1|965169|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 965169-965200 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
NZ_CP040566_4 4.1|965169|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 965169-965200 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
NZ_CP040566_3 3.5|964881|33|NZ_CP040566|PILER-CR 964881-964913 33 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142293-142325 8 0.758
NZ_CP040566_3 3.5|964881|33|NZ_CP040566|PILER-CR 964881-964913 33 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29080 8 0.758
NZ_CP040566_3 3.12|964943|32|NZ_CP040566|CRISPRCasFinder,CRT 964943-964974 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
NZ_CP040566_4 4.2|965230|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 965230-965261 32 NZ_CP016489 Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence 8862-8893 8 0.75
NZ_CP040566_4 4.2|965230|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 965230-965261 32 NZ_CP016476 Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence 151600-151631 8 0.75
NZ_CP040566_4 4.8|965596|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 965596-965627 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
NZ_CP040566_2 2.4|948416|32|NZ_CP040566|CRISPRCasFinder,CRT 948416-948447 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
NZ_CP040566_4 4.9|965657|32|NZ_CP040566|CRISPRCasFinder,CRT 965657-965688 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
NZ_CP040566_4 4.9|965657|32|NZ_CP040566|CRISPRCasFinder,CRT 965657-965688 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
NZ_CP040566_2 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 948233-948264 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1885546-1885577 11 0.656
NZ_CP040566_2 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 948233-948264 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 56201-56232 11 0.656
NZ_CP040566_2 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 948233-948264 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 83399-83430 11 0.656
NZ_CP040566_2 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 948233-948264 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1487158-1487189 11 0.656
NZ_CP040566_2 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT 948233-948264 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 597699-597730 11 0.656

1. spacer 3.11|964882|32|NZ_CP040566|CRISPRCasFinder,CRT matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781 

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

2. spacer 3.11|964882|32|NZ_CP040566|CRISPRCasFinder,CRT matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

3. spacer 4.1|965169|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**

4. spacer 4.1|965169|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**

5. spacer 4.1|965169|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**

6. spacer 3.5|964881|33|NZ_CP040566|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758 

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

7. spacer 3.5|964881|33|NZ_CP040566|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 8, identity: 0.758 

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

8. spacer 3.12|964943|32|NZ_CP040566|CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggcgtac-----aggctgttagatgagaaattacc	CRISPR spacer
-----atactaataaggctgtttgatgcgaaattacc	Protospacer
     .***     ******** **** *********

9. spacer 4.2|965230|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *.

10. spacer 4.2|965230|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016476 (Synechococcus sp. PCC 7003 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

ttcttgaatatgattgcgggtatatgtggata	CRISPR spacer
ctcttgaatatgattgcgggtttagatttacc	Protospacer
.******************** ** .*  *.

11. spacer 4.8|965596|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75 

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  .

12. spacer 2.4|948416|32|NZ_CP040566|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*

13. spacer 4.9|965657|32|NZ_CP040566|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688 

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

14. spacer 4.9|965657|32|NZ_CP040566|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688 

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

15. spacer 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

16. spacer 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

17. spacer 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgactcgatcgccttccagaccaaccttctgg	Protospacer
.   .***** ************ ****.  .

18. spacer 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

19. spacer 2.1|948233|32|NZ_CP040566|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1220106 : 1295648 91 Salmonella_phage(44.07%) holin,tRNA,head,lysis,terminase,integrase,protease,capsid,transposase,tail attL 1212187:1212203|attR 1301495:1301511
DBSCAN-SWA_2 1648679 : 1678260 31 Salmonella_phage(41.67%) holin,tail,protease NA
DBSCAN-SWA_3 1750311 : 1759482 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1827790 : 1838296 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_5 1924287 : 1975050 68 Salmonella_phage(88.52%) portal,holin,head,plate,lysis,terminase,integrase,protease,tail attL 1918865:1918879|attR 1935341:1935355
DBSCAN-SWA_6 2079079 : 2085888 11 Salmonella_phage(33.33%) integrase,tail attL 2081289:2081311|attR 2091004:2091026
DBSCAN-SWA_7 2874872 : 2959608 93 Salmonella_phage(45.45%) portal,holin,tRNA,terminase,lysis,integrase,protease,tail attL 2898966:2898985|attR 2970754:2970773
DBSCAN-SWA_8 3023774 : 3032506 8 Enterobacteria_phage(14.29%) transposase,protease NA
DBSCAN-SWA_9 3640566 : 3684317 66 Salmonella_phage(41.54%) portal,holin,head,coat,lysis,integrase,protease,tail attL 3631637:3631653|attR 3693532:3693548
DBSCAN-SWA_10 4438025 : 4485070 50 Burkholderia_phage(40.91%) tRNA,plate,tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage