Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040656 Lysobacter enzymogenes strain YC36 chromosome, complete genome 10 crisprs cas3,csa3,DEDDh,Cas9_archaeal,WYL 2 7 1 0

Results visualization

1. NZ_CP040656
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_1 509785-509884 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_2 1247807-1247918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_3 1813850-1813947 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_4 2409632-2409734 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_5 2643310-2643380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_6 3351986-3352249 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_7 3843635-3843734 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_8 5121732-5121833 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_9 5425279-5425374 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040656_10 5557742-5557848 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP040656_6 6.5|3352208|18|NZ_CP040656|CRISPRCasFinder 3352208-3352225 18 NZ_CP040656.1 5125155-5125172 1 0.944
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP040656.1 2636808-2636831 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP040656.1 3845483-3845506 2 0.917

1. spacer 6.5|3352208|18|NZ_CP040656|CRISPRCasFinder matches to position: 5125155-5125172, mismatch: 1, identity: 0.944 

cgattcccaggcccgcga	CRISPR spacer
cgattcccagtcccgcga	Protospacer
********** *******

2. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to position: 2636808-2636831, mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgccagcggcgcggcggccgg	Protospacer
***** ***** ************

3. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to position: 3845483-3845506, mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcggcggcgccgcggcggccgg	Protospacer
*****.*.****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 108991-109015 2 0.92
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 144181-144204 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP045481 Amycolatopsis sp. YIM 10 plasmid pAmyYIM10, complete sequence 20202-20225 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 767054-767077 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 92042-92065 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 722055-722078 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 97761-97784 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP044332 Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence 86749-86772 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 41663-41686 2 0.917
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 370058-370081 2 0.917
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 814074-814098 3 0.88
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1401368-1401392 3 0.88
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP015043 Rhodovulum sp. P5 plasmid pRGUI04, complete sequence 17695-17719 3 0.88
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 105433-105457 3 0.88
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1168670-1168694 3 0.88
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 459885-459908 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 463187-463210 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1763584-1763607 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 244663-244686 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 CP021183 Sphingomonas wittichii DC-6 plasmid pDC02, complete sequence 97517-97540 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 144955-144978 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 217226-217249 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 924527-924550 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 153829-153852 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1908277-1908300 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1908277-1908300 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 JN698995 Mycobacterium phage Dori, complete genome 20442-20465 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 118088-118111 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 168864-168887 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 188469-188492 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 171679-171702 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 192278-192301 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 230253-230276 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 325709-325732 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1898331-1898354 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 170151-170174 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 783284-783307 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 173006-173029 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 496602-496625 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 178757-178780 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 169030-169053 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 169037-169060 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 166596-166619 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 170174-170197 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 173023-173046 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 188985-189008 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 166868-166891 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 230321-230344 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 166215-166238 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 188985-189008 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 166868-166891 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 188985-189008 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 166215-166238 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 188985-189008 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 166868-166891 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 166868-166891 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 166868-166891 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 175600-175623 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 166215-166238 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 178740-178763 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 178746-178769 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 174130-174153 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 174694-174717 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 166557-166580 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 166215-166238 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 188985-189008 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 166215-166238 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 166215-166238 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 166868-166891 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 184564-184587 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 25299-25322 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 362399-362422 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 515042-515065 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 25305-25328 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 24726-24749 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 211043-211066 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 21545-21568 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 112344-112367 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 22418-22441 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 363957-363980 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 21550-21573 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 21544-21567 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 21544-21567 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 458105-458128 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 21541-21564 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 26414-26437 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 26414-26437 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 515051-515074 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 21547-21570 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 26414-26437 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 140248-140271 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 19831-19854 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 26414-26437 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 21544-21567 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1107458-1107481 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 24662-24685 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 21547-21570 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 26414-26437 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 291801-291824 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 63974-63997 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP032625 Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence 20595-20618 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 21547-21570 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP038638 Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence 27201-27224 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 514844-514867 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 24724-24747 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 124869-124892 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 MT114163 Mycobacterium phage Settecandela, complete genome 63516-63539 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 MK937592 Mycobacterium phage Phrappuccino, complete genome 63516-63539 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 252762-252785 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1554088-1554111 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 3404-3427 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 396885-396908 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 598789-598812 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_008539 Arthrobacter sp. FB24 plasmid 3, complete sequence 93934-93957 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP015744 Shinella sp. HZN7 plasmid pShin-08, complete sequence 41661-41684 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 23534-23557 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 379962-379985 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 705621-705644 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 252454-252477 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP029051 Miniimonas sp. S16 plasmid pS16-2, complete sequence 22418-22441 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 292504-292527 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 274641-274664 3 0.875
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 MK686071 Streptomyces phage Mischief19, complete genome 38106-38129 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 196492-196515 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 61816-61839 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1194627-1194650 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 117860-117883 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 573183-573206 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1233453-1233476 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_009806 Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence 26843-26866 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 MK181567 Escherichia coli plasmid pESBL20150097, complete sequence 6837-6860 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 44730-44753 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 95330-95353 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3962615-3962638 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 246607-246630 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 371071-371094 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP044976 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence 196683-196706 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 715187-715210 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 715165-715188 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_014159 Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence 33058-33081 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 169448-169471 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 MH825699 Streptomyces phage Darolandstone, complete genome 28135-28158 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 811471-811494 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 750060-750083 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 468514-468537 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 510336-510359 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2456328-2456351 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1473111-1473134 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_020060 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence 172620-172643 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 185329-185352 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 209084-209107 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1458671-1458694 3 0.875
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 456840-456863 3 0.875
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NC_014753 Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence 73123-73147 4 0.84
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NC_014753 Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence 74069-74093 4 0.84
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP021368 Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence 21006-21030 4 0.84
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP021364 Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence 40088-40112 4 0.84
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 254895-254919 4 0.84
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 324942-324966 4 0.84
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 113602-113625 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP049749 Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence 91635-91658 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 232926-232949 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 671621-671644 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP018078 Sulfitobacter sp. AM1-D1 plasmid unnamed2, complete sequence 55639-55662 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 365555-365578 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 7472-7495 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 160603-160626 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1141545-1141568 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP015008 Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence 12452-12475 4 0.833
NZ_CP040656_6 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder 3352010-3352033 24 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1049130-1049153 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 445871-445894 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1428101-1428124 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1018969-1018992 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP013739 Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence 149473-149496 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1412928-1412951 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 166093-166116 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 173470-173493 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 124488-124511 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 30165-30188 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1457026-1457049 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 131639-131662 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 278165-278188 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP009804 Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence 7744-7767 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 200646-200669 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 345703-345726 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_023282 Streptomyces sp. FR1 plasmid pFRL2, complete sequence 23655-23678 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1644693-1644716 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1180298-1180321 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1233026-1233049 4 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 278166-278189 4 0.833
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 204486-204510 5 0.8
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 203064-203088 5 0.8
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2207323-2207347 5 0.8
NZ_CP040656_5 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder 2643333-2643357 25 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2273633-2273657 5 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1284453-1284482 5 0.833
NZ_CP040656_6 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder 3352112-3352135 24 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 102437-102460 5 0.792
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 257860-257889 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_012854 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence 61729-61758 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 19502-19531 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 19497-19526 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 19472-19501 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 10732-10761 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP017427 Methylobacterium sp. XJLW plasmid unnamed1, complete sequence 100795-100824 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 231569-231598 6 0.8
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 215726-215755 6 0.8
NZ_CP040656_1 1.1|509820|30|NZ_CP040656|CRISPRCasFinder 509820-509849 30 NZ_CP022747 Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence 220460-220489 7 0.767
NZ_CP040656_1 1.1|509820|30|NZ_CP040656|CRISPRCasFinder 509820-509849 30 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 164340-164369 7 0.767
NZ_CP040656_1 1.1|509820|30|NZ_CP040656|CRISPRCasFinder 509820-509849 30 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 121671-121700 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 KU160644 Arthrobacter phage Galaxy, complete genome 12674-12703 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 28164-28193 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_014642 Achromobacter xylosoxidans A8 plasmid pA82, complete sequence 129396-129425 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 MT776811 Arthrobacter phage King2, complete genome 22844-22873 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 125559-125588 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 279380-279409 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP033228 Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence 145582-145611 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_009426 Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence 6271-6300 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 147673-147702 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP018232 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence 50600-50629 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_002033 Novosphingobium aromaticivorans plasmid pNL1, complete sequence 134121-134150 7 0.767
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1665728-1665757 7 0.767
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 143282-143312 7 0.774
NZ_CP040656_1 1.1|509820|30|NZ_CP040656|CRISPRCasFinder 509820-509849 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1747808-1747837 8 0.733
NZ_CP040656_1 1.1|509820|30|NZ_CP040656|CRISPRCasFinder 509820-509849 30 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 661662-661691 8 0.733
NZ_CP040656_3 3.1|1813883|32|NZ_CP040656|CRISPRCasFinder 1813883-1813914 32 NZ_CP047181 Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence 32422-32453 8 0.75
NZ_CP040656_3 3.1|1813883|32|NZ_CP040656|CRISPRCasFinder 1813883-1813914 32 NZ_CP047184 Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence 34794-34825 8 0.75
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_015382 Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence 230610-230639 8 0.733
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 509915-509944 8 0.733
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 938361-938390 8 0.733
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 MT952853 Arthrobacter phage Orcanus, complete genome 9919-9948 8 0.733
NZ_CP040656_6 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder 3352058-3352087 30 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 537488-537517 8 0.733
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1732709-1732739 8 0.742
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1011073-1011103 8 0.742
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 MK937607 Gordonia phage Zipp, complete genome 54414-54444 8 0.742
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 MT498036 Gordonia Phage Zitch, complete genome 52699-52729 8 0.742
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1662234-1662264 9 0.71
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 279109-279139 9 0.71
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 555107-555137 9 0.71
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 549819-549849 9 0.71
NZ_CP040656_10 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder 5557780-5557810 31 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 549902-549932 9 0.71

1. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtagtccggcagcgccgcga	Protospacer
 *********** ************

2. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcgccgcggcggccgc	Protospacer
******* ***************

3. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP045481 (Amycolatopsis sp. YIM 10 plasmid pAmyYIM10, complete sequence) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcggcggcgccgcggcggccgg	Protospacer
*****.*.****************

4. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcgccgcgccggccgg	Protospacer
*******.******** *******

5. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgatggcgccgcggcggccgg	Protospacer
******..****************

6. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cagcgacagcgccgcgtcggccgg	Protospacer
*.************** *******

7. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccgcgggcgccgg	Protospacer
*****************  *****

8. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcggcagcgccgcggcggcctg	Protospacer
*****.**************** *

9. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgagggcgccgcggcggccgg	Protospacer
****** .****************

10. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 2, identity: 0.917 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacatcgccgcggcggcggg	Protospacer
******** ************ **

11. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 3, identity: 0.88 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtcgtccggcagcgccgcga	Protospacer
 ****** **** ************

12. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 3, identity: 0.88 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtcgtccggcagcgccgcga	Protospacer
 ****** **** ************

13. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 3, identity: 0.88 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtcgtcctccagcgccgcga	Protospacer
 ****** ***** ***********

14. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 3, identity: 0.88 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtaatccggcagcgccgcga	Protospacer
 *******.*** ************

15. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtcgtccggcagcgccgcga	Protospacer
 ****** **** ************

16. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

17. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

18. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

19. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

20. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to CP021183 (Sphingomonas wittichii DC-6 plasmid pDC02, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
ggccgacagcgccgcggcggccgc	Protospacer
 * ********************

21. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

22. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

23. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

24. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

25. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

26. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

27. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cgccgacagcgccgcggcggccat	Protospacer
** *******************.

28. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

29. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

30. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

31. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

32. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccgcggcagcctc	Protospacer
******************.***

33. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

34. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

35. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

36. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

37. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

38. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

39. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgacagcgccgcggcggctcg	Protospacer
.********************. *

40. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

41. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

42. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

43. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

44. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

45. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

46. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

47. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

48. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

49. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

50. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

51. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

52. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

53. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

54. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

55. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

56. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

57. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

58. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

59. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

60. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

61. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

62. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

63. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

64. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

65. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

66. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

67. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

68. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

69. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

70. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

71. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

72. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

73. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

74. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

75. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

76. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

77. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

78. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

79. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

80. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcggccgt	Protospacer
.**** *****************

81. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

82. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcgccgcggcgtccga	Protospacer
*******.*********** ***.

83. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cgccgaccgcgccgcggcggccga	Protospacer
** **** ***************.

84. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

85. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

86. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
ccgcgacatcgccgcggcggccgt	Protospacer
* ****** **************

87. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

88. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgagagcgccgcggcgggcgt	Protospacer
****** ************* **

89. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

90. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
catcgaccgcgccgcggcggccgg	Protospacer
*. **** ****************

91. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

92. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

93. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

94. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgtcagcgccgcggcgaccgg	Protospacer
.**** *************.****

95. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

96. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

97. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

98. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cgccgaccgcgccgcggcggccga	Protospacer
** **** ***************.

99. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

100. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

101. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgtcgcggcagccga	Protospacer
***********.******.****.

102. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

103. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

104. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

105. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcggcagcgccgcggcggcggg	Protospacer
.****.*************** **

106. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

107. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

108. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

109. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcaacagcggcgcggcggccga	Protospacer
****.****** ***********.

110. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cgccgacagcgcctcggcggccgt	Protospacer
** ********** *********

111. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP032625 (Gryllotalpicola sp. 2DFW10M-5 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
ccgcgacatcgccgcggcggccgc	Protospacer
* ****** **************

112. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgaccgcggcgcggcggccga	Protospacer
******* *** ***********.

113. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP038638 (Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccgtgacggccgt	Protospacer
**************.*.******

114. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cgccgaccgcgccgcggcggccga	Protospacer
** **** ***************.

115. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

116. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
ctgcgacagcgccgcggcagccgt	Protospacer
* ****************.****

117. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cagcgacagcgccgcggtggccgc	Protospacer
*.***************.*****

118. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cagcgacagcgccgcggtggccgc	Protospacer
*.***************.*****

119. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcgacgcggcggccgc	Protospacer
*******.*** ***********

120. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacatcgccgcgacggccgc	Protospacer
******** *******.******

121. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacaacgccgccgcggccgc	Protospacer
********.****** *******

122. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccgcgccgcccga	Protospacer
**************** ** ***.

123. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcgccgcggcggctgc	Protospacer
*******.*************.*

124. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_008539 (Arthrobacter sp. FB24 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgtcaccgccgcggcggccgc	Protospacer
***** ** **************

125. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccccggcgggcga	Protospacer
************* ****** **.

126. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
gggcggcagcgccgcggcggcctg	Protospacer
 ****.**************** *

127. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

128. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcggcagcgccgcggcggcggg	Protospacer
.****.*************** **

129. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

130. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029051 (Miniimonas sp. S16 plasmid pS16-2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacctcgccgcggcggccga	Protospacer
*******  **************.

131. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgccagcgccgcgccggccga	Protospacer
***** ********** ******.

132. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacggcggcgcggcggccga	Protospacer
*******.*** ***********.

133. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to MK686071 (Streptomyces phage Mischief19, complete genome) position: , mismatch: 3, identity: 0.875 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggctacagcggcgcggcggccga	Protospacer
**** ****** ***********.

134. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
ccccgaagccgacgcggccgccga	Protospacer
  *********************.

135. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgcggaagccgacgcggccgccgc	Protospacer
 ** *******************

136. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgtcgcggccgccga	Protospacer
 ********** ***********.

137. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccggcgcggccgccgc	Protospacer
 **********.***********

138. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgtcgcggccgcctg	Protospacer
 ********** ********** *

139. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
agccgcagccgacgcggacgccga	Protospacer
***** *********** *****.

140. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_009806 (Kineococcus radiotolerans SRS30216 = ATCC BAA-149 plasmid pKRAD01, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgtcgccgccgccgg	Protospacer
 ********** *** ********

141. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to MK181567 (Escherichia coli plasmid pESBL20150097, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgacgaagccgacgaggccgccgg	Protospacer
 * *********** *********

142. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaggccgacacggccgccgg	Protospacer
 *****.******.**********

143. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgccgcgcccgccgg	Protospacer
 ********** **** *******

144. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaggccgacgcggccgtcgg	Protospacer
 *****.*************.***

145. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaggccgtcgcggccgccgg	Protospacer
 *****.**** ************

146. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaagccgccgccgccgccgg	Protospacer
 ********** *** ********

147. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
ggccgaagccgaccaggccgccgg	Protospacer
.************  *********

148. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaagccgccgccgccgccgg	Protospacer
 ********** *** ********

149. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaagccgccgccgccgccgg	Protospacer
 ********** *** ********

150. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
agccgtagccgacgcggtcgccga	Protospacer
***** ***********.*****.

151. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
agccgaagccgaagcgcccgccgc	Protospacer
************ *** ******

152. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to MH825699 (Streptomyces phage Darolandstone, complete genome) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaggccgacgccgccgccgg	Protospacer
 *****.******** ********

153. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgccgaggccgccgg	Protospacer
 ********** ** *********

154. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
agccgacgccgacgcggtcgccga	Protospacer
****** **********.*****.

155. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
agccgaagccgaggcggccgacgc	Protospacer
************ ******* **

156. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgtcgaagacgacgcggccgccgg	Protospacer
 *.***** ***************

157. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
agccgcagccgacgcggacgccga	Protospacer
***** *********** *****.

158. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaagccgccgccgccgccgg	Protospacer
 ********** *** ********

159. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_020060 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899a, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
aggcgaagccgacgcggccgcagc	Protospacer
** ****************** *

160. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgatgccgccgcggccgccgg	Protospacer
 ***** **** ************

161. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaagccgacgcgcacgccgg	Protospacer
 ***************  ******

162. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
tgccgaagccgccgccgccgccgg	Protospacer
 ********** *** ********

163. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 3, identity: 0.875 

agccgaagccgacgcggccgccgg	CRISPR spacer
ggctgaagccgacgaggccgccgg	Protospacer
.**.********** *********

164. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 4, identity: 0.84 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ttcgcgtaggccttcagcgccgcga	Protospacer
. ******* *** ***********

165. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 4, identity: 0.84 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ttcgcgtaggccttcagcgccgcga	Protospacer
. ******* *** ***********

166. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 4, identity: 0.84 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
accgcgttgtcctgccgcgccgcga	Protospacer
  ***** ******* *********

167. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 4, identity: 0.84 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
accgcgttgtcctgccgcgccgcga	Protospacer
  ***** ******* *********

168. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 4, identity: 0.84 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
aacgcggagtccagcagcgccgcga	Protospacer
 .**** ***** ************

169. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 4, identity: 0.84 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
cgggcgtagtcgtgcagcgccgccg	Protospacer
** ******** *********** .

170. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
gagcgccagcgccgcggcggccga	Protospacer
 .*** *****************.

171. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcggcgcggcggcgtc	Protospacer
*********** *********

172. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
gtgcgccagcgccgcggcggccgc	Protospacer
  *** *****************

173. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
gaacgacagcgccgcggcgcccgg	Protospacer
 ..**************** ****

174. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP018078 (Sulfitobacter sp. AM1-D1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tggcgacagcgccgcggcgccccc	Protospacer
.****************** **

175. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
gatcgacagccccgcggcggccgg	Protospacer
 . ******* *************

176. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccgccgcggcgaa	Protospacer
*************** ***** ..

177. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
cggcgacagcgccgccgcggcgaa	Protospacer
*************** ***** ..

178. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
gaacgacagcgccgcggcgcccgg	Protospacer
 ..**************** ****

179. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
aggcgacagcgtcgcggcggccct	Protospacer
 **********.**********

180. spacer 6.1|3352010|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 4, identity: 0.833 

cggcgacagcgccgcggcggccgg	CRISPR spacer
tagcgacagcgccgcggcagccgc	Protospacer
..****************.****

181. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
tcccgaagccgacgctgccgccgc	Protospacer
  ************* *******

182. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

183. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

184. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
gaccgacgccgacgcggccgccga	Protospacer
..**** ****************.

185. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

186. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgatgcggccgccca	Protospacer
 ***********.********* .

187. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgatgcggccgccca	Protospacer
 ***********.********* .

188. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

189. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

190. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

191. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
ggccgaagccgacgcggccgggga	Protospacer
.*******************  *.

192. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

193. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP009804 (Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
caccgaagccgacccggccgccgc	Protospacer
 .*********** *********

194. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaagccgatgcggccgccca	Protospacer
 ***********.********* .

195. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

196. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_023282 (Streptomyces sp. FR1 plasmid pFRL2, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
ggccgaagccgtcgcggccgccca	Protospacer
.********** ********** .

197. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

198. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

199. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

200. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.833 

agccgaagccgacgcggccgccgg	CRISPR spacer
cgccgaaggcgacgcggccgccca	Protospacer
 ******* ************* .

201. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 5, identity: 0.8 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtagtcctgcagcaccgacg	Protospacer
 *****************.***  .

202. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 5, identity: 0.8 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ggcgcgtagtcctgcagcaccgacg	Protospacer
 *****************.***  .

203. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.8 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ctgcaatagtcctgcagcgccgcga	Protospacer
*    .*******************

204. spacer 5.1|2643333|25|NZ_CP040656|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.8 

cgcgcgtagtcctgcagcgccgcga	CRISPR spacer
ctgcaatagtcctgcagcgccgcga	Protospacer
*    .*******************

205. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.833 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgaagatgccggcgcgagcgccgacatcga	Protospacer
*** ** ******************...**

206. spacer 6.3|3352112|24|NZ_CP040656|CRISPRCasFinder matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 5, identity: 0.792 

agccgaagccgacgcggccgccgg	CRISPR spacer
cctggaagccgacgcggccgccgt	Protospacer
  . *******************

207. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaagacggcgcgagcgccgcgtttgg	Protospacer
******** **************   .**.

208. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaagacggcgcgagcgccgcgtttgg	Protospacer
******** **************   .**.

209. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgatgaagccggcgcgaccgccgagccggg	Protospacer
***.************* ******  * *.

210. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgatgaagccggcgcgaccgccgagccggg	Protospacer
***.************* ******  * *.

211. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgatgaagccggcgcgaccgccgagccggg	Protospacer
***.************* ******  * *.

212. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaagccggcccgagcgccataggtgt	Protospacer
************* ********.  * **

213. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaggccggcgcgggcgccgctcatga	Protospacer
******.*********.****** .  ***

214. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaggccggcgcgggcgccgctcatga	Protospacer
******.*********.****** .  ***

215. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 6, identity: 0.8 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaagccggcgagcgcgccggagatca	Protospacer
************** * ******. * * *

216. spacer 1.1|509820|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagcgacgaactaaccgacctgcgctctt	CRISPR spacer
cgagcgacgaactcatcgacctgcgcacga	Protospacer
  *********** *.********** *

217. spacer 1.1|509820|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagcgacgaactaaccgacctgcgctctt	CRISPR spacer
cgagcgacgaactcatcgacctgcgcacga	Protospacer
  *********** *.********** *

218. spacer 1.1|509820|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.767 

gcagcgacgaactaaccgacctgcgctctt	CRISPR spacer
ggcgcgacgaactcgccgacctgcgcgatg	Protospacer
*  ********** .***********  *

219. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to KU160644 (Arthrobacter phage Galaxy, complete genome) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
ggacgaagccggcgcgatcgccgccgtcac	Protospacer
 **************** ***** **...

220. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
gcacgaagccggcgcgcgcgccgaacatgt	Protospacer
  ************** *******   **

221. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_014642 (Achromobacter xylosoxidans A8 plasmid pA82, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
gaactgcgccagcgcgagcgccgacgctgg	Protospacer
 .** . ***.******************.

222. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to MT776811 (Arthrobacter phage King2, complete genome) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
ctcttcagcctgcgcgagcgccgacgccga	Protospacer
*  .  **** ****************.**

223. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgagcccggcgcgagcgccgccctggc	Protospacer
******. *************** * . *

224. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
ggcggaagccggcgcgaccgccgacctcga	Protospacer
 *  ************* ******* ..**

225. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP033228 (Sphingobium yanoikuyae strain SJTF8 plasmid pF2, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
gcaccaagccggcgcgatcgccgacattgt	Protospacer
  ** ************ *******..**

226. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_009426 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
gcaccaagccggcgcgatcgccgacattgt	Protospacer
  ** ************ *******..**

227. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga--	CRISPR spacer
cgacgaagccggcgcgcgcgc--gctccggct	Protospacer
**************** ****  .* *.*.

228. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaagacggcgcgcgcgccgcgtttgg	Protospacer
******** ******* ******   .**.

229. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_002033 (Novosphingobium aromaticivorans plasmid pNL1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
gcaccaagccggcgcgatcgccgacattgt	Protospacer
  ** ************ *******..**

230. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cgacgaagccggcgcccgcgccgtgatgga	Protospacer
***************  ******  .. **

231. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.774 

cccgttccagatcgcggcgatcg---gaccggaa	CRISPR spacer
gtcgttcccgatggcggcgatcggaagaccg---	Protospacer
 .****** *** **********   *****

232. spacer 1.1|509820|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733 

gcagcgacgaactaaccgacctgcgctctt	CRISPR spacer
gcagcgacgaactgaccgaccaggccatcg	Protospacer
*************.******* *  * ..

233. spacer 1.1|509820|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733 

gcagcgacgaactaaccgacctgcgctctt	CRISPR spacer
gcagcgacgaactgatcgacctggccgagg	Protospacer
*************.*.*******  *

234. spacer 3.1|1813883|32|NZ_CP040656|CRISPRCasFinder matches to NZ_CP047181 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcactcacttctctacactcgcttctcgaccg--	CRISPR spacer
cgactctcttctcgacactcgct--tcgagcagc	Protospacer
  **** ****** *********  **** *.

235. spacer 3.1|1813883|32|NZ_CP040656|CRISPRCasFinder matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

gcactcacttctctacactcgcttctcgaccg--	CRISPR spacer
cgactctcttctcgacactcgct--tcgagcagc	Protospacer
  **** ****** *********  **** *.

236. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 8, identity: 0.733 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
gctcgaagccggcgccagcgccgatctcga	Protospacer
   ************ ********. ..**

237. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.733 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
ggccgaacccggcgcgaccgccgacgacat	Protospacer
 * **** ********* ******** ..

238. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
cggcgaagccggcgggagcgccgttccgcc	Protospacer
**.*********** ******** . *

239. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to MT952853 (Arthrobacter phage Orcanus, complete genome) position: , mismatch: 8, identity: 0.733 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
ctggatagcccgcgcgagcgccgacgccgg	Protospacer
* . . **** ****************.*.

240. spacer 6.2|3352058|30|NZ_CP040656|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgacgaagccggcgcgagcgccgacgctga	CRISPR spacer
ggccgaacccggcgcgaccgccgacgacat	Protospacer
 * **** ********* ******** ..

241. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.742 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cccgttcgagatggcggcgatcgtccggcgt	Protospacer
******* **** **********  * * .

242. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.742 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
ccagttccagatcgaggcgatcggcttcgtg	Protospacer
** *********** ********* .. * .

243. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 8, identity: 0.742 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cgtgttgcagatcgcgacgatcggactgtcc	Protospacer
* .*** *********.*********.*

244. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to MT498036 (Gordonia Phage Zitch, complete genome) position: , mismatch: 8, identity: 0.742 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cgtgttgcagatcgcgacgatcggactgtcc	Protospacer
* .*** *********.*********.*

245. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.71 

--cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
ttccggttc--gatcgcggcgatctggcggacg	Protospacer
  ** ****  ************* *.* *. .

246. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 9, identity: 0.71 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cggcggccggatcgcggcgatcggtccgggg	Protospacer
*     **.*************** ****..

247. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cagtgaccagatcgaggcgagcggaccggcg	Protospacer
*     ******** ***** ******** .

248. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 9, identity: 0.71 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cggcggccggatcgcggcgatcggtccgggg	Protospacer
*     **.*************** ****..

249. spacer 10.1|5557780|31|NZ_CP040656|CRISPRCasFinder matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 9, identity: 0.71 

cccgttccagatcgcggcgatcggaccggaa	CRISPR spacer
cggcggccggatcgcggcgatcggtccgggg	Protospacer
*     **.*************** ****..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 228362 : 239111 11 Pseudomonas_phage(55.56%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage