Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP040749 Flavobacteriaceae bacterium 10Alg115 chromosome, complete genome 2 crisprs cas3,WYL,DEDDh,csa3,RT 0 1 6 0

Results visualization

1. NZ_CP040749
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040749_1 1853243-1853333 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP040749_2 4414950-4415051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP040749_1 1.1|1853276|25|NZ_CP040749|CRISPRCasFinder 1853276-1853300 25 MK804893 Aeromonas phage 2-L372D, complete genome 78128-78152 4 0.84
NZ_CP040749_1 1.1|1853276|25|NZ_CP040749|CRISPRCasFinder 1853276-1853300 25 NC_048770 Aeromonas phage 2_L372X, complete genome 74075-74099 4 0.84
NZ_CP040749_1 1.1|1853276|25|NZ_CP040749|CRISPRCasFinder 1853276-1853300 25 AP013517 Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S30-C51 15013-15037 5 0.8

1. spacer 1.1|1853276|25|NZ_CP040749|CRISPRCasFinder matches to MK804893 (Aeromonas phage 2-L372D, complete genome) position: , mismatch: 4, identity: 0.84

gggactcataattttagttttagat	CRISPR spacer
gatactcataattttagttttacac	Protospacer
*. ******************* *.

2. spacer 1.1|1853276|25|NZ_CP040749|CRISPRCasFinder matches to NC_048770 (Aeromonas phage 2_L372X, complete genome) position: , mismatch: 4, identity: 0.84

gggactcataattttagttttagat	CRISPR spacer
gatactcataattttagttttacac	Protospacer
*. ******************* *.

3. spacer 1.1|1853276|25|NZ_CP040749|CRISPRCasFinder matches to AP013517 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S30-C51) position: , mismatch: 5, identity: 0.8

gggactcataattttagttttagat	CRISPR spacer
tttactcataattttagttttagtg	Protospacer
   ********************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 135577 : 144547 8 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_2 499384 : 631393 105 Acinetobacter_phage(21.43%) tRNA,integrase,protease,transposase attL 501754:501770|attR 557233:557249
DBSCAN-SWA_3 1379121 : 1395697 15 Acinetobacter_phage(50.0%) integrase,transposase attL 1388374:1388387|attR 1395993:1396006
DBSCAN-SWA_4 2759236 : 2773111 12 unidentified_phage(33.33%) integrase,transposase attL 2753883:2753898|attR 2767107:2767122
DBSCAN-SWA_5 2778002 : 2798501 21 Thermus_phage(28.57%) integrase,transposase attL 2775666:2775681|attR 2803003:2803018
DBSCAN-SWA_6 3764715 : 3826649 58 Hokovirus(20.0%) integrase,protease,transposase attL 3770274:3770290|attR 3829577:3829593
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage