1. spacer 3.2|2697734|25|NZ_CP034412|CRT matches to MN693593 (Marine virus AFVG_25M494, complete genome) position: , mismatch: 3, identity: 0.88
gctatggtcaggcagtcaatccgcc CRISPR spacer
cctatggtcgggcattcaatccgcc Protospacer
********.**** **********
2. spacer 3.4|2697823|26|NZ_CP034412|CRT matches to NZ_CP011404 (Lactobacillus salivarius str. Ren plasmid pR1, complete sequence) position: , mismatch: 4, identity: 0.846
ttccagccaagatcggccaatccaac CRISPR spacer
gtccagccaagataggccaatctaat Protospacer
************ ********.**.
3. spacer 3.4|2697823|26|NZ_CP034412|CRT matches to NZ_CP020859 (Lactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
ttccagccaagatcggccaatccaac CRISPR spacer
gtccagccaagataggccaatctaat Protospacer
************ ********.**.
4. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcggcgtcggcgtcggcatcagcatca Protospacer
**.****************.*** * *
5. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atctgcgtcggcgtcggcatcagcatca Protospacer
** ****************.*** * *
6. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atctgcgtcggcgtcggcatcagcatca Protospacer
** ****************.*** * *
7. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 5, identity: 0.821
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcggcgtcggcgtcggcatcagcatca Protospacer
**.****************.*** * *
8. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP028567 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence) position: , mismatch: 5, identity: 0.821
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
ataaccgtcggcgtcggcatcggcctga Protospacer
* * ***************..******
9. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
tacagcgtcggcgtcggcatcagcgcct Protospacer
* ******************.*** .
10. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcagcgtcggcatcggcatcagcgtcg Protospacer
***********.*******.*** * .
11. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP041205 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-2, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcagcatcggcgtcggcatcagcgtcg Protospacer
*****.*************.*** * .
12. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atccgcgtcggcgtcggcatcagcatcc Protospacer
** ****************.*** *
13. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcagcatcggcgtcggcatcagcatcg Protospacer
*****.*************.*** * .
14. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcggcgtcggcgtcggcatcagcatct Protospacer
**.****************.*** *
15. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcggcgtcggcgtcggcatcagcatct Protospacer
**.****************.*** *
16. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcggcgtcggcgtcggcatcagcatct Protospacer
**.****************.*** *
17. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcggcgtcggcgtcggcatcagcatct Protospacer
**.****************.*** *
18. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
gtcagcgtcggcatcggcatcagcatct Protospacer
***********.*******.*** *
19. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atcagcgtcggcatcggcatcagcatct Protospacer
***********.*******.*** *
20. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atcagcgtcggcgtctgcatcagcatct Protospacer
************** ****.*** *
21. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atcagcgtcggcgtctgcatcagcatct Protospacer
************** ****.*** *
22. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atcagcgtcggcgtctgcatcagcatct Protospacer
************** ****.*** *
23. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atcagcgtcggcgtctgcatcagcatct Protospacer
************** ****.*** *
24. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
atcagcgtcggcatcggcatcagcatct Protospacer
***********.*******.*** *
25. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NC_031122 (Gordonia phage Eyre, complete genome) position: , mismatch: 6, identity: 0.786
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
ctgggcgtcggcgtcggccttcgcctgc Protospacer
.* .************** ** *****
26. spacer 2.6|2655603|28|NZ_CP034412|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
ttcagcgtcggcgtcggcattagcctga CRISPR spacer
aacagcgtcggcgtcggcataaggaaac Protospacer
****************** ** .
27. spacer 2.5|2655549|34|NZ_CP034412|CRT matches to MG030346 (Proteus phage PM87, complete genome) position: , mismatch: 11, identity: 0.676
ctgagcatccgcaccggactcagtatcagcgtcg CRISPR spacer
ggagtcatacgcatcggactcagtatcagagatc Protospacer
.. *** ****.*************** * .
28. spacer 2.5|2655549|34|NZ_CP034412|CRT matches to MN840486 (Proteus phage P16-2532, complete genome) position: , mismatch: 11, identity: 0.676
ctgagcatccgcaccggactcagtatcagcgtcg CRISPR spacer
ggagtcatacgcatcggactcagtatcagagatc Protospacer
.. *** ****.*************** * .
29. spacer 2.5|2655549|34|NZ_CP034412|CRT matches to MN604053 (Escherichia phage E21, complete genome) position: , mismatch: 11, identity: 0.676
ctgagcatccgcaccggactcagtatcagcgtcg CRISPR spacer
ggagtcatacgcatcggactcagtatcagagatc Protospacer
.. *** ****.*************** * .
30. spacer 2.5|2655549|34|NZ_CP034412|CRT matches to CP059058 (Proteus phage ASh-2020a, complete genome) position: , mismatch: 11, identity: 0.676
ctgagcatccgcaccggactcagtatcagcgtcg CRISPR spacer
ggagtcatacgcatcggactcagtatcagagatc Protospacer
.. *** ****.*************** * .
31. spacer 2.9|2655771|34|NZ_CP034412|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 11, identity: 0.676
agttgcatcagcctgagcgtccgcaccggactca CRISPR spacer
tcaaccatcagcctgagcgtgcgcagcggcgaga Protospacer
*************** **** *** *
32. spacer 2.9|2655771|34|NZ_CP034412|CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 11, identity: 0.676
agttgcatcagcctgagcgtccgcaccggactca CRISPR spacer
tcaaccatcagcctgagcgtgcgcagcggcgaga Protospacer
*************** **** *** *