Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP031054 Moorella thermoacetica strain 39073-HH chromosome, complete genome 3 crisprs csa3,cas2,cas1,cas4,cas7,cas8c,cas5,cas3,WYL,DinG,cas6,RT 0 3 2 0

Results visualization

1. NZ_CP031054
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031054_1 512606-514297 TypeI I-C,III-B
23 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031054_2 726455-726546 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP031054_3 1789091-1792110 Unclear NA
46 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP031054_3 3.25|1790684|35|NZ_CP031054|PILER-CR,CRISPRCasFinder,CRT 1790684-1790718 35 NC_015938 Salmonella phage 7-11, complete genome 16459-16493 8 0.771
NZ_CP031054_3 3.33|1791203|35|NZ_CP031054|PILER-CR,CRISPRCasFinder,CRT 1791203-1791237 35 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 353801-353835 8 0.771
NZ_CP031054_1 1.17|513795|35|NZ_CP031054|PILER-CR,CRISPRCasFinder,CRT 513795-513829 35 NZ_CP016024 Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence 69648-69682 10 0.714

1. spacer 3.25|1790684|35|NZ_CP031054|PILER-CR,CRISPRCasFinder,CRT matches to NC_015938 (Salmonella phage 7-11, complete genome) position: , mismatch: 8, identity: 0.771

taaaatgcttgatgcggatttaattgatgtttata	CRISPR spacer
tggacatattgatgcggctttaattgatgttaata	Protospacer
*..*    ********* ************* ***

2. spacer 3.33|1791203|35|NZ_CP031054|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.771

tgctacgtccagcttcaatatccgctataaaagaa	CRISPR spacer
agtcaaagccagcttcaatatccgctatataagat	Protospacer
 *..* . ********************* **** 

3. spacer 1.17|513795|35|NZ_CP031054|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 10, identity: 0.714

tttcggcttcggggccttatattccttgccatcca	CRISPR spacer
cgccaacttcgtggcctgatattccttgccatttg	Protospacer
. .*..***** ***** **************...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 372311 : 423191 56 uncultured_Caudovirales_phage(20.0%) transposase,integrase attL 418850:418864|attR 425858:425872
DBSCAN-SWA_2 2152617 : 2161500 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage